ID: 1078783600

View in Genome Browser
Species Human (GRCh38)
Location 11:14464134-14464156
Sequence GATACACTTGGAGTTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078783600 Original CRISPR GATACACTTGGAGTTCAGAA TGG (reversed) Intronic
901732623 1:11291271-11291293 AATATACTTGGATTTCAGCAAGG + Intronic
903860935 1:26364157-26364179 GCTTAACTTGGAGTCCAGAAAGG + Intronic
906006001 1:42471017-42471039 GAGACACATGGAGTTTAGGATGG + Intronic
910133660 1:83940441-83940463 GATACATTTGGAGGTCACATAGG + Intronic
911658956 1:100478147-100478169 GACACATTTGGGATTCAGAATGG - Intronic
912251312 1:108015143-108015165 TGGACACTTGGACTTCAGAATGG + Intergenic
921327546 1:214001614-214001636 GAAAGACTTGAAGTTTAGAAAGG + Intronic
923048995 1:230377104-230377126 TATGCACTTGGAGTTAGGAAGGG - Intronic
924603119 1:245508761-245508783 GATACATTTGGGACTCAGAAAGG - Intronic
1063695589 10:8332160-8332182 GAAGCACGTGGAGCTCAGAAAGG - Intergenic
1063797338 10:9527317-9527339 CAAACACCTGGATTTCAGAAAGG - Intergenic
1065189708 10:23198084-23198106 GATACACTTGGACTTGAGGCTGG + Intergenic
1065320401 10:24503726-24503748 GACACAATTGCAGTTCAGAGGGG + Intronic
1066261739 10:33735997-33736019 GCTGCACCTGGATTTCAGAAAGG - Intergenic
1069654618 10:70078549-70078571 GAAACACCTGGAGCTCAGAGAGG - Intronic
1072376443 10:94821295-94821317 AATACACTTGCTGTTCAAAATGG - Intronic
1072407571 10:95169088-95169110 GGAACACTTGGAGCTCAGGAAGG - Intergenic
1073722032 10:106183560-106183582 GACACACAGGGAGTTGAGAATGG + Intergenic
1074581734 10:114725590-114725612 GATGCACTGGGAGTTAGGAAAGG + Intergenic
1075793097 10:125099505-125099527 GCTCCAGTTGGAGTTCAGGATGG - Intronic
1076289339 10:129332239-129332261 GACATACTTGGAGTCCAAAAAGG - Intergenic
1077477963 11:2799882-2799904 GGGACACTTGGAGCTCAGGAGGG - Intronic
1078783600 11:14464134-14464156 GATACACTTGGAGTTCAGAATGG - Intronic
1079296477 11:19239626-19239648 GAACAACTTGGAATTCAGAAAGG - Intronic
1081119754 11:39252188-39252210 AATACACTTGCAGATCAGAATGG - Intergenic
1084113603 11:67028963-67028985 GATTCCCTTGTAGTTCAGAGAGG - Intronic
1085727803 11:78969450-78969472 GATACACTAAGAATCCAGAATGG - Intronic
1087034755 11:93743942-93743964 GTTACAGTTGGAGCTGAGAAAGG - Intronic
1088001484 11:104887071-104887093 AATAAACTTGGAGTACAGGAAGG + Intergenic
1089438726 11:118495976-118495998 GATATACTTGGATATCAGAAAGG + Intronic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091715158 12:2771709-2771731 GAAACAGATGGAGATCAGAAGGG + Intergenic
1091933806 12:4418519-4418541 AATACATTTGGATTTAAGAATGG + Intergenic
1095795085 12:46210289-46210311 GATAAACCAGGAGTACAGAATGG + Intronic
1097450353 12:59730748-59730770 GAAATACTTGCATTTCAGAATGG + Intronic
1097754592 12:63395601-63395623 GATGCTCTTGGAATTCAGACTGG - Intergenic
1100387326 12:94115706-94115728 GATAGACTTGGCCTTCAGTAGGG + Intergenic
1101299884 12:103468327-103468349 GTTACATTTGGAATCCAGAATGG - Intronic
1105612688 13:21982976-21982998 GAGAAACTTGGGGTTCATAAAGG - Intergenic
1108064627 13:46564582-46564604 GATCCACTTGGACCTCAGGAAGG + Intronic
1108072211 13:46639884-46639906 GATACTCTCTGAGTGCAGAAAGG - Intronic
1112225489 13:97535537-97535559 GATACAGAAGGTGTTCAGAAGGG + Intergenic
1114449633 14:22816691-22816713 CAGACAGTTGGATTTCAGAATGG - Intronic
1114616245 14:24069843-24069865 GATAGACTTGGGGTTCTGAGAGG + Intergenic
1116099458 14:40414514-40414536 AATATGTTTGGAGTTCAGAATGG + Intergenic
1116974711 14:51103001-51103023 CAAACACTGGGAGTTCTGAAGGG - Intergenic
1118187250 14:63548814-63548836 GATAAATTTGGATTTCAGAGTGG - Intergenic
1122143507 14:99675871-99675893 GAAACGCTTGGAGGTAAGAAAGG - Exonic
1126333368 15:47558445-47558467 GATACACTGCAAGTTCAGGAAGG + Intronic
1126677482 15:51173015-51173037 GAATCTTTTGGAGTTCAGAAAGG + Intergenic
1127696988 15:61459865-61459887 GAGAAAATTGGAGCTCAGAAAGG + Intergenic
1128201672 15:65814133-65814155 GATAAATTTGGAGTTCTGGAGGG - Intronic
1135645486 16:24157861-24157883 AATTGACTTGGAGTTCAGCACGG - Intronic
1136523302 16:30811627-30811649 CAAACACTTGAAGTCCAGAAGGG + Intergenic
1141287751 16:82688246-82688268 GATACACATGGAGCCCAGCAGGG - Intronic
1141821486 16:86449263-86449285 GAGGCACTTGGATTTCAAAAAGG - Intergenic
1149525196 17:57350420-57350442 GAAACACTTGGAGTACTGGATGG + Intronic
1155429667 18:25742433-25742455 TAGACACTTGGACTCCAGAAAGG + Intergenic
1155578456 18:27276096-27276118 GTTAGACTTGTAGTTAAGAAAGG + Intergenic
1157942236 18:51942082-51942104 GATAGACTTGGAGTTTTAAAAGG - Intergenic
1159870473 18:73755475-73755497 GAGACACTGGGGGTTTAGAATGG - Intergenic
1165952350 19:39481369-39481391 GATAGACTTGGAGGTCAGAATGG - Intronic
1166910844 19:46155276-46155298 GCTACAGTTTCAGTTCAGAAAGG - Intronic
1166923127 19:46245496-46245518 GCTACAGTTTCAGTTCAGAAAGG + Intergenic
1168455181 19:56501756-56501778 CAGACACTTGGAGCTCTGAAAGG + Intergenic
925402246 2:3583511-3583533 GTTTCACTTGGAGTGCACAATGG + Intergenic
925404255 2:3595683-3595705 GAAAGACTTTGAGTTCAGATGGG + Intronic
925768670 2:7261842-7261864 TATAGTCTTGGAGTTCAGAGTGG + Intergenic
927656368 2:24950250-24950272 GATACGCTGTGAGGTCAGAATGG + Intronic
927956241 2:27209215-27209237 GATACGCTTGGAGAACAGACAGG - Intronic
928963675 2:36955625-36955647 GGCAGATTTGGAGTTCAGAAAGG - Intronic
930277485 2:49330443-49330465 GATACATCTGGAGTTCAGCTGGG - Intergenic
931552593 2:63463024-63463046 GATAATCTAGAAGTTCAGAATGG + Intronic
932280061 2:70483120-70483142 GATACACGTTGAGTTCAACAAGG - Intronic
933886363 2:86721452-86721474 GGTACACTGGGAGAACAGAAGGG - Intronic
933923815 2:87075254-87075276 GGTACACTGGGAGAACAGAAGGG + Intergenic
937787851 2:125923401-125923423 GATGCACTTGAAGTGCAGCATGG + Intergenic
937793804 2:125993267-125993289 GATATATTTGGAGTGCTGAAAGG - Intergenic
942213503 2:173695209-173695231 GATACATTTGGGTTTCAGAGGGG - Intergenic
942405319 2:175647385-175647407 GCTACAGTTGTAGTGCAGAAAGG - Intergenic
943663961 2:190589129-190589151 GAGAGACTTGTAGTCCAGAAGGG - Intergenic
945219552 2:207469741-207469763 GATACATTTGGTGTTCAGTGGGG + Intergenic
946582774 2:221148350-221148372 AGTTCACTTTGAGTTCAGAAAGG - Intergenic
946974196 2:225129884-225129906 GATCCACTTGAATTTTAGAAAGG + Intergenic
948443644 2:238014922-238014944 AATACACTTGGATTTCTGACTGG - Intronic
1168842098 20:916093-916115 GAGACACTTGTAGTCCAGCACGG - Exonic
1169558608 20:6774642-6774664 GAAACAGTTGCAGTTCAGAGAGG - Intronic
1170594781 20:17796951-17796973 GATACATTTGGATTTAGGAAAGG + Intergenic
1171101827 20:22390886-22390908 AATAAACTTGGAGTTTGGAATGG + Intergenic
1177812469 21:25939030-25939052 GACACACTTTGATTTCTGAAAGG + Intronic
1178689124 21:34736485-34736507 GAGACATTTAGAGTTCAGACAGG - Intergenic
1181440344 22:22932385-22932407 CAGACACTTGGAGCTCAGAGGGG + Intergenic
1182882370 22:33744641-33744663 GACACACTTGGACTTCTGGATGG + Intronic
1183729711 22:39611107-39611129 GTTACTCCTGGAGTTCACAAGGG + Intronic
952030624 3:29137978-29138000 GATACTCTTGGAGTTTAGAGGGG - Intergenic
954471136 3:50696390-50696412 GATGCACATCGAGTTCACAAAGG + Intronic
954628261 3:52034683-52034705 GAGACTCTTGGAATTCAGCAGGG + Intergenic
955260717 3:57387648-57387670 GACTCCCTTGGAATTCAGAATGG + Intronic
956488572 3:69747450-69747472 GAGAGAATTAGAGTTCAGAAAGG - Intronic
964157075 3:153599446-153599468 AATAGACTTCAAGTTCAGAAAGG + Intergenic
965000563 3:162947373-162947395 AATACACTTGGTGTTGAGCAAGG - Intergenic
965817163 3:172648789-172648811 GATACCCTGAGGGTTCAGAAGGG - Intronic
966339076 3:178905139-178905161 GATACACTTGGGTTTTAGAGGGG - Intergenic
976118801 4:81757837-81757859 GCTACACTTTGATTTCTGAATGG - Intronic
977143527 4:93406835-93406857 CATGCTCTTGGAGCTCAGAAGGG - Intronic
981592857 4:146383719-146383741 GAGAAACCTGAAGTTCAGAAAGG + Intronic
981797700 4:148615836-148615858 GAAACACTTGGAGATCTGCATGG + Intergenic
982139076 4:152300211-152300233 GATTCACTTTGAGTTAATAATGG - Intergenic
982816750 4:159895324-159895346 ATTTTACTTGGAGTTCAGAATGG + Intergenic
987775203 5:22356681-22356703 GATATACTTGGAGTTAATCATGG - Intronic
990702969 5:58495542-58495564 GATACACATAGGATTCAGAAAGG - Exonic
991521531 5:67503501-67503523 GACACAGTGGGAGTTCAAAATGG + Intergenic
992664383 5:78992438-78992460 GATAGACTTGAACATCAGAAAGG + Intergenic
993787787 5:92165179-92165201 GATACATTTGGATATCAGATTGG - Intergenic
995544639 5:113217842-113217864 GAAACACTGAGAGGTCAGAAAGG + Intronic
997017926 5:129959047-129959069 TATTCACTTGGGATTCAGAAGGG - Intronic
997145927 5:131433163-131433185 GATGCACTTTGAGTTCTGACTGG + Intronic
999881493 5:155869582-155869604 GACAGACCTGGGGTTCAGAATGG - Intergenic
1000617284 5:163441356-163441378 GAGACATTTGGAAATCAGAATGG + Intronic
1001368770 5:171174644-171174666 GCTCCACTTGGGTTTCAGAAAGG + Intronic
1001851896 5:174975007-174975029 AATTCACTTGGAGTAAAGAAAGG + Intergenic
1003691166 6:8355030-8355052 GATGGGTTTGGAGTTCAGAAGGG + Intergenic
1006761759 6:36468208-36468230 GATGTACTTGGAGTTTAGCAGGG - Intronic
1006990458 6:38210927-38210949 GACCCACTTGGTGTTCAGGAGGG - Intronic
1008710166 6:54215335-54215357 GATAAAATTGAAGTTCAGTAAGG - Intronic
1008877628 6:56347003-56347025 GATAGACCTGGAGTTGAGATGGG - Intronic
1009772965 6:68166918-68166940 GTTACACTTGTATTTCACAAAGG + Intergenic
1010130522 6:72487398-72487420 GTTATTCTTGGAGTTCATAATGG - Intergenic
1011797217 6:90969628-90969650 GATATTCTTGGACTTCAAAATGG - Intergenic
1013501952 6:110760983-110761005 GATACATCTGAAGTTCAGTAAGG + Intronic
1014212658 6:118722599-118722621 CATACACTTCGAGTCCAGAGGGG - Intergenic
1016326713 6:142911249-142911271 AATACAGTTGGGATTCAGAAAGG + Intronic
1020210971 7:6158067-6158089 TATGAACTTGGAGTTAAGAATGG + Intronic
1020702042 7:11497037-11497059 AATTCACTTACAGTTCAGAATGG + Intronic
1021766886 7:23958534-23958556 TAGACACTTGGACTTCTGAAGGG - Intergenic
1021838187 7:24701337-24701359 AACACATTCGGAGTTCAGAATGG - Intronic
1021934693 7:25618378-25618400 CATACACCTGGGGTCCAGAATGG - Intergenic
1022178766 7:27898083-27898105 AAGACACTTGGAGTTGAGTAAGG - Intronic
1023183178 7:37506807-37506829 GAAAAACTTGAAATTCAGAATGG + Intergenic
1023282052 7:38580930-38580952 GAAAAACTTGGAGTTTAGACTGG + Intronic
1024904221 7:54358411-54358433 TATACACTTGGACTTAAGAAGGG + Intergenic
1029542667 7:101193365-101193387 GATACCCTTGGAGTTCAGGCAGG - Intergenic
1031289093 7:119909285-119909307 GATACAATTCAAGTTGAGAATGG + Intergenic
1031299308 7:120043427-120043449 GATACAATTCGAGTTGAGAATGG - Intergenic
1031424127 7:121585145-121585167 GAACCTCTGGGAGTTCAGAAGGG - Intergenic
1032122446 7:129167082-129167104 AGTCCACATGGAGTTCAGAAGGG + Intronic
1034331451 7:150286720-150286742 GTTACACTTGGACTTCGGACAGG + Intronic
1034569651 7:151944914-151944936 GAGGAACTTGGAGGTCAGAAGGG + Intergenic
1034666592 7:152823141-152823163 GTTACACTTGGACTTCGGACAGG - Intronic
1037079307 8:14763965-14763987 GGTACACCTGGTGTTCAGATGGG + Intronic
1037299885 8:17440427-17440449 GACACACTATGAGTTAAGAAAGG + Intergenic
1039896729 8:41721812-41721834 GTTACACTTGCATTTCAGAAAGG + Intronic
1040731057 8:50447515-50447537 GAGACACTTGGAAATTAGAAAGG - Intronic
1042655757 8:71094228-71094250 GAAAAACTTAGATTTCAGAATGG - Intergenic
1045737682 8:105317101-105317123 GACACAATTTGAGATCAGAATGG + Intronic
1045888266 8:107124730-107124752 AATACACTTGAGGATCAGAAAGG - Intergenic
1046104122 8:109645825-109645847 GGTAAATTTGAAGTTCAGAAGGG - Exonic
1048219585 8:132529129-132529151 AAAACACTTGGAGTACAGAGAGG + Intergenic
1059514382 9:114879263-114879285 GATTGACTTGCAGTTCAGCATGG - Intergenic
1186211253 X:7252815-7252837 CATACACTTTGAGTTTTGAAAGG + Intronic
1186321130 X:8426559-8426581 CATGACCTTGGAGTTCAGAAAGG - Intergenic
1186562469 X:10627275-10627297 ATTACACTTGGGTTTCAGAATGG - Intronic
1187888980 X:23915581-23915603 GCTGGACTTGGAGTTCTGAAGGG - Intronic
1189961485 X:46328422-46328444 GAGATACTTGGAGGTCAGCAGGG + Intergenic
1190259198 X:48787403-48787425 GATAGAATTGGAGTAGAGAAAGG - Intronic
1190819373 X:53959302-53959324 GAGACTCTTGGAGTTGAGTATGG - Intronic
1190819828 X:53963052-53963074 GAGACTCTTGGAGTTGAGTATGG - Intronic
1192709595 X:73566035-73566057 GTTACCCTGGGAGATCAGAATGG - Intronic
1193367174 X:80649076-80649098 GAGAAAATTGAAGTTCAGAAAGG + Intergenic
1195484385 X:105387000-105387022 CATACATTTGAATTTCAGAATGG + Intronic
1196987098 X:121286309-121286331 GATATACTTGTATTTCAGGAAGG + Intergenic
1197425374 X:126290389-126290411 GAAACACTTAGAGGTGAGAAAGG + Intergenic
1199799821 X:151239351-151239373 AATTGACTTGGAGATCAGAAAGG + Intergenic
1201062284 Y:10058544-10058566 GATAGACTTGCAGGTCAGGATGG + Intergenic