ID: 1078784128

View in Genome Browser
Species Human (GRCh38)
Location 11:14471307-14471329
Sequence CAGTGCAAACATTATTAACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078784126_1078784128 -8 Left 1078784126 11:14471292-14471314 CCTTCTTGTACCAAACAGTGCAA 0: 1
1: 0
2: 0
3: 4
4: 130
Right 1078784128 11:14471307-14471329 CAGTGCAAACATTATTAACTCGG 0: 1
1: 0
2: 0
3: 17
4: 148
1078784125_1078784128 0 Left 1078784125 11:14471284-14471306 CCAAACTTCCTTCTTGTACCAAA 0: 1
1: 0
2: 1
3: 23
4: 274
Right 1078784128 11:14471307-14471329 CAGTGCAAACATTATTAACTCGG 0: 1
1: 0
2: 0
3: 17
4: 148
1078784124_1078784128 19 Left 1078784124 11:14471265-14471287 CCAGTGAGATTATAAGCAACCAA 0: 1
1: 0
2: 1
3: 29
4: 252
Right 1078784128 11:14471307-14471329 CAGTGCAAACATTATTAACTCGG 0: 1
1: 0
2: 0
3: 17
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078784128 Original CRISPR CAGTGCAAACATTATTAACT CGG Intronic
905535312 1:38716799-38716821 CAGAGCAAAGATTCTTATCTAGG - Intergenic
906744639 1:48213177-48213199 CAGTGCACAGATTATTATTTGGG - Intergenic
907175896 1:52522043-52522065 TAATTCAAACATTATTAATTTGG + Intronic
910042473 1:82869301-82869323 CAGTGCAAAAATTATTACAGTGG - Intergenic
910110949 1:83682791-83682813 AAGTGCAAACCTTTTTGACTTGG - Intergenic
912398145 1:109364940-109364962 CATTGCAAACAGAATGAACTTGG - Intronic
913079409 1:115368503-115368525 CAGTGCTAGCATTTTTAGCTGGG - Intergenic
913247257 1:116881076-116881098 CAGAGTCAACATTTTTAACTTGG + Intergenic
915010629 1:152682726-152682748 CAGTTCTAACACTTTTAACTTGG - Intergenic
915704873 1:157834283-157834305 CATTGCAAACTTATTTAACTGGG - Intronic
916527391 1:165624020-165624042 CAGTGGAAACTTTATTAAGTTGG + Intergenic
919316113 1:195971951-195971973 CAGTGGAAACATGACTCACTGGG - Intergenic
919394706 1:197030750-197030772 TAGTGCAAACTTTATTTAATGGG + Intergenic
919644527 1:200080921-200080943 CTGTGTAATCATTATTAACAGGG - Intronic
924835480 1:247642789-247642811 CAGTACCAACATTATTTGCTTGG + Intergenic
1063305787 10:4898874-4898896 CAGTGCACTCATTTTTAACAAGG - Intergenic
1065039991 10:21683607-21683629 CAGGGTAAACATCATTCACTAGG - Intronic
1067154658 10:43768082-43768104 CAGTGCAAAGAATATTATCAGGG - Intergenic
1067999806 10:51319386-51319408 CAGGCCAAAAATTGTTAACTAGG - Intronic
1068992609 10:63165283-63165305 CAGTAAAAACATTATCAATTAGG + Intergenic
1070090130 10:73276563-73276585 AAGGGCAAGAATTATTAACTGGG - Intronic
1070636503 10:78132476-78132498 CAGAGCAAACAATATTATCAGGG - Intergenic
1074694751 10:116039845-116039867 CAGTGCAAGCCTCAGTAACTGGG - Intergenic
1075830252 10:125403942-125403964 CAGTGAAAGCAATATTAACAGGG - Intergenic
1078784128 11:14471307-14471329 CAGTGCAAACATTATTAACTCGG + Intronic
1079161961 11:18003530-18003552 CAGTATAAAAATTATTAACAAGG - Intronic
1079837109 11:25349406-25349428 CACAGCAAAGGTTATTAACTAGG - Intergenic
1080349083 11:31360960-31360982 CAGTACCAAGATTATTAAATTGG + Intronic
1081179773 11:39970948-39970970 CAATACAAACATCATTAATTTGG + Intergenic
1082644834 11:55709790-55709812 CAGTGCCAAGATTATTCAATAGG - Intergenic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1087116714 11:94533270-94533292 TAGTGCAAATATTTTTAAGTAGG - Intergenic
1087585367 11:100112863-100112885 CAGTCATAACATTATTAACTGGG - Intronic
1088997504 11:115014265-115014287 CAGTGAAGAGATTATTGACTGGG + Intergenic
1089361862 11:117895800-117895822 CAGACCAAACATTTTTAATTTGG - Intergenic
1090193485 11:124794666-124794688 CAGGGCAAAGATAACTAACTTGG - Intronic
1091914228 12:4256622-4256644 CAGTGCAAACATCACTCTCTGGG + Intergenic
1092925599 12:13269372-13269394 CTGAGCAAAGAGTATTAACTAGG - Intergenic
1093437565 12:19153427-19153449 AAATACAAACTTTATTAACTTGG - Intronic
1095212822 12:39512815-39512837 CAGTGGAAACATTATAAGCCAGG + Intergenic
1102641976 12:114374791-114374813 CAGTGTGCACATCATTAACTAGG - Intronic
1106986766 13:35362232-35362254 CTGTGCAAACACTATTATGTTGG + Intronic
1108138286 13:47389372-47389394 CAGTGAAAGCAGTATTAACAGGG + Intergenic
1108938454 13:55916778-55916800 CAGAGCAAATATTATTAAGATGG + Intergenic
1112301235 13:98232383-98232405 CTTTGCATACATTATTAACTAGG - Intronic
1113003701 13:105675234-105675256 CATAGCAAGCATTATTAAATTGG + Intergenic
1115666620 14:35556700-35556722 CAGTGAAAACAATATAGACTTGG - Intronic
1116654475 14:47633881-47633903 TGGTGCAAACTCTATTAACTGGG + Intronic
1117938051 14:60929482-60929504 CTGTGCAAAAATGATGAACTTGG - Intronic
1119082257 14:71706323-71706345 CAGTATAAAAATTATTAACGAGG - Intronic
1120093197 14:80358065-80358087 CAGTGCCAACATTTTTAATAAGG + Intronic
1121319168 14:92981143-92981165 CAGGGCAGGCATTATTATCTGGG - Intronic
1122492167 14:102125343-102125365 CATTGCAAGAATTATCAACTGGG - Intronic
1127132852 15:55885108-55885130 CAGTGGAAACCTTATTACCTTGG + Intronic
1130295240 15:82642875-82642897 CAGTGTAAACATTAATATTTAGG + Intronic
1131377275 15:91935923-91935945 CTGTGCAAACTTTAATAATTAGG - Intronic
1138747866 16:59384736-59384758 CCATGCAACCATTTTTAACTGGG + Intergenic
1140337847 16:74127450-74127472 CAGAGCAAAAATTATTATCAGGG + Intergenic
1140400623 16:74668055-74668077 CTCTGCAGGCATTATTAACTAGG + Intergenic
1145781253 17:27565141-27565163 CAGTGCAAACCATAATAAATGGG - Intronic
1147815692 17:43208610-43208632 CAGCAGAAAGATTATTAACTTGG - Intronic
1151025815 17:70675111-70675133 CAGTGCAAGAATCTTTAACTAGG - Intergenic
1151209325 17:72532560-72532582 CAGTCCAAACATAATTGTCTCGG - Intergenic
1155588161 18:27392427-27392449 CAGAGCAAAGGTTTTTAACTTGG + Intergenic
1155852958 18:30795353-30795375 CAGTGCAAACATTTATGACAAGG + Intergenic
1159247162 18:65821875-65821897 CAGAGAAAACATTATTAACGTGG - Intronic
1163814698 19:19457438-19457460 CAGTGTAAACATGATTAACAAGG + Intronic
1164879403 19:31718697-31718719 CAGTTCAAATATTTTTATCTCGG - Intergenic
1165210766 19:34234015-34234037 AAATGCAAAAATTATTAGCTAGG + Intergenic
927024201 2:19048984-19049006 CAGTGCTGACATTTTTAACCAGG - Intergenic
929246304 2:39707270-39707292 CAGTGAAAACAAAATTAACAGGG - Intronic
930727649 2:54697347-54697369 CAGTGAAAACCTTACTAACCAGG + Intergenic
933639537 2:84744730-84744752 CAAAGCAAACATAATTAAATGGG - Intronic
936700976 2:115011501-115011523 CAGAGCAAACAATATTACCATGG - Intronic
938290741 2:130148761-130148783 CACTGCTAACACTATTAACTCGG - Intergenic
938465805 2:131524192-131524214 CACTGCTAACACTATTAACTCGG + Intergenic
947037576 2:225876501-225876523 TACTTCAAACATTCTTAACTCGG + Intergenic
947693585 2:232162842-232162864 CAATGCTAACATTATGAACAGGG - Intronic
948702847 2:239771274-239771296 CACTGCAGACATTATGATCTGGG - Intronic
1169055878 20:2620586-2620608 CAGCGGAAACATTACCAACTTGG + Intronic
1169823249 20:9737376-9737398 CAGAGCAAACAATATTACCAAGG + Intronic
1170041300 20:12042678-12042700 CAAAGCAAACATTAATAAATGGG - Intergenic
1170878824 20:20276816-20276838 CATTGCCAACATTAGTAATTTGG + Intronic
1172023020 20:31928149-31928171 CTGTGCAAACATTTTTAAGTGGG - Intronic
1173238721 20:41273619-41273641 CAGTGCCAAGATGATTCACTGGG - Intronic
1173393726 20:42658553-42658575 CAGTGCACATATTACTAGCTGGG - Intronic
1175626929 20:60496478-60496500 CAAGGCAAACACTATTAACCAGG + Intergenic
1177232691 21:18342884-18342906 CATTTAAAACATTATTAATTTGG + Intronic
1178292841 21:31384301-31384323 CAGGGAAAACATTTTTAATTTGG - Intronic
1179434832 21:41353535-41353557 CAGTGCCAAGATTATTTAATGGG + Intronic
949666736 3:6347685-6347707 TAGTGCAATCAGTTTTAACTCGG + Intergenic
949828725 3:8190890-8190912 CAGTGCCAAGAATATAAACTGGG - Intergenic
955609635 3:60743533-60743555 TAGAGCAAACATTTTAAACTTGG + Intronic
956203831 3:66735761-66735783 TAGTGCCATCATTAGTAACTTGG + Intergenic
956507890 3:69961961-69961983 CACAGAAAACATTATTAATTAGG + Intronic
957946706 3:87072501-87072523 CAGTGAAAACAGCATGAACTTGG - Intergenic
959259898 3:104064277-104064299 AAGTATAAACATTATTCACTAGG - Intergenic
960568432 3:119160597-119160619 TAATGCAAAAATTCTTAACTTGG + Intronic
961833422 3:129637214-129637236 TAATAAAAACATTATTAACTTGG - Intergenic
963687141 3:148450800-148450822 AAATACAAACATTATTAAGTTGG + Intergenic
964508959 3:157428556-157428578 AAGTGCAAATATTATTACATTGG - Intronic
964869491 3:161297666-161297688 CAGTGCCAATATGATAAACTGGG - Intergenic
965370105 3:167851644-167851666 GAGAGGAAACATTATTAACTAGG + Intergenic
965796403 3:172444657-172444679 CAGTACAAAAATTATTAAAAAGG - Intergenic
968096561 3:195935316-195935338 CAGTGGAAACATTATAAGCCAGG + Intergenic
970394184 4:15649234-15649256 AAGTGCAAACATTTTTAACCCGG + Intronic
971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG + Intergenic
972746690 4:41940157-41940179 CAGGTCAAACATTTTTAAATAGG + Intronic
974454664 4:62111991-62112013 AAGTGAAAATATTATAAACTGGG - Intergenic
975125036 4:70772523-70772545 AAGTGAAAACATTATTTATTGGG - Intronic
975405613 4:73985460-73985482 CACTGCAAACATTAAAATCTGGG - Intergenic
976171429 4:82308953-82308975 CAGTGGAAACCTTATAAACAAGG - Intergenic
979048491 4:115900004-115900026 CAATGAAAACATTAAAAACTTGG + Intergenic
979122669 4:116923186-116923208 CAGTGAAAACCTTATGAACCAGG - Intergenic
980878547 4:138686532-138686554 CAGTGGAAATATTAATAACATGG - Intergenic
987143144 5:14965937-14965959 CAATTCCAACATTATTATCTTGG + Intergenic
988342249 5:29987751-29987773 CAGAGCAAAGATTGTCAACTGGG - Intergenic
988957626 5:36334831-36334853 CAATATAAACATTATTAACAAGG - Intergenic
989326132 5:40197554-40197576 CCGTTCAAACATTATCTACTTGG + Intergenic
994226501 5:97257596-97257618 CAGTGAAAGCAGTATTAACATGG + Intergenic
994738931 5:103594308-103594330 CAGTTCATACATTATCACCTGGG + Intergenic
994986759 5:106943298-106943320 CAATGCAACAATTCTTAACTGGG - Intergenic
998202087 5:140133041-140133063 CAGAGCAAGGATTCTTAACTTGG - Intergenic
1000752962 5:165119578-165119600 CAGTGCAAATAAAATAAACTAGG - Intergenic
1002154629 5:177266670-177266692 CAGTGAGAACAAGATTAACTCGG + Intronic
1004103862 6:12644951-12644973 CCCTGCAAACAGAATTAACTAGG + Intergenic
1008563587 6:52745878-52745900 CACTGCAAACATCAATAACAAGG - Intergenic
1009905975 6:69869928-69869950 TAGTACAAACATTAGGAACTAGG + Intronic
1010329501 6:74606621-74606643 CAGTGAAAAAAATATGAACTTGG - Intergenic
1011161148 6:84391835-84391857 TAGTGCAAAGTATATTAACTTGG + Intergenic
1012257001 6:97045503-97045525 GAGTGCAGATATTATTTACTTGG - Intronic
1012613416 6:101245798-101245820 CAGAGCAAAGAATATTACCTTGG - Intergenic
1013881492 6:114907468-114907490 TAGTGCAAAAAATATTAGCTGGG - Intergenic
1015314292 6:131800560-131800582 CAGTAAAAACATAATTAGCTGGG - Intergenic
1019984360 7:4644517-4644539 CAAACCAAACATTATTTACTGGG - Intergenic
1020577800 7:9956463-9956485 CTTTGCAAATATGATTAACTTGG + Intergenic
1020869506 7:13609440-13609462 CAGTGCAAACTATATTATTTTGG - Intergenic
1024513647 7:50223705-50223727 CAGTGCCAACATTATTCATTTGG + Intergenic
1024591217 7:50886754-50886776 CATTGCTAACATTATTGATTTGG - Intergenic
1028074879 7:86499806-86499828 CAATGAAAACTATATTAACTAGG + Intergenic
1030620658 7:111786735-111786757 CACTGCACACATTATGAATTAGG - Intronic
1032656443 7:133935675-133935697 CAGTGCAAACAGTTTTTACTTGG - Intronic
1037445150 8:18957788-18957810 AAGTGCATTCATTATTAACTTGG - Intronic
1037914160 8:22762188-22762210 CTGTGCAAATTTTATTAACCAGG + Intronic
1039110201 8:34033523-34033545 CAGTACAAAGATTGTTAATTTGG + Intergenic
1042502274 8:69522494-69522516 CAGTGGAAATATCATTAATTAGG + Intronic
1042995009 8:74687794-74687816 CAGTTCAAAATTTATTAACTGGG + Intronic
1043412378 8:80011256-80011278 AAGAGCAAACAGTATCAACTTGG + Intronic
1045602247 8:103731285-103731307 CAGTGGAAACCTTATAGACTAGG - Intronic
1046175681 8:110572108-110572130 CAGGGGAAACATTTTTCACTTGG - Intergenic
1046271991 8:111908581-111908603 CAGTGCTTACATTTTTATCTGGG + Intergenic
1047348734 8:124053349-124053371 CAGTGCTTACTTTATTAAGTCGG - Intronic
1048676546 8:136789832-136789854 CAGTGCAAACATGAGTAACATGG + Intergenic
1051134526 9:13903563-13903585 CAGTGTCCACATTATAAACTGGG + Intergenic
1051576136 9:18617723-18617745 CAATGAAAACACTATTAATTTGG + Intronic
1052158074 9:25219719-25219741 GAATGCAAACATAATTTACTTGG - Intergenic
1057530460 9:95840959-95840981 CAGTGCATAAATTGTAAACTAGG + Intergenic
1057905961 9:98983733-98983755 CACTGCTACCATTATTAACCAGG + Intronic
1188937698 X:36197207-36197229 CAGTTAAAATATTATTAACTAGG - Intergenic
1192329254 X:70161301-70161323 CAGTGGAAACATCTTTAAATTGG - Intronic
1192855067 X:75000208-75000230 CAGTGAAAGCATTACTAACAGGG - Intergenic
1193105584 X:77668379-77668401 CAGAGCAAACAGAATCAACTAGG - Intronic
1193675800 X:84450540-84450562 CAATGCAAATATTATTAGATTGG + Intronic
1195139690 X:101946968-101946990 CAGAGCCAATATTATTAAGTAGG + Intergenic
1197695923 X:129549956-129549978 CAGTGCAAATACTACTAAATGGG - Intronic
1198037714 X:132818168-132818190 CAGTACAACTATTAATAACTAGG - Intronic