ID: 1078796945

View in Genome Browser
Species Human (GRCh38)
Location 11:14601569-14601591
Sequence GGCTTAATGTAAATAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078796940_1078796945 17 Left 1078796940 11:14601529-14601551 CCGACTCAGTCTCTTGAGCTGGT 0: 1
1: 0
2: 5
3: 43
4: 604
Right 1078796945 11:14601569-14601591 GGCTTAATGTAAATAGAACAAGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078796945 Original CRISPR GGCTTAATGTAAATAGAACA AGG Intronic
901292676 1:8136484-8136506 GGATTAATGTAAAAATCACATGG - Intergenic
903110145 1:21125832-21125854 GAATTAATGTGCATAGAACAGGG - Intronic
905067866 1:35198787-35198809 GGCTTAGTGCAAATAGAGTAGGG - Intergenic
907042095 1:51270679-51270701 GGATTACTCTAAATAGCACAAGG + Intronic
909393821 1:75147167-75147189 GACTCACTGTAAACAGAACATGG - Intronic
917753406 1:178075360-178075382 GGGTTGGTGGAAATAGAACAAGG + Intergenic
918232875 1:182551516-182551538 GGTTTAATGGAGATAGAGCAGGG - Intronic
918338215 1:183543174-183543196 GGTTTCATGTAAACAGAAAAGGG + Intronic
919206856 1:194429582-194429604 GGCTTGCTGGAAATAAAACAGGG + Intergenic
1064978159 10:21139847-21139869 GGATTAAAGTATATGGAACATGG + Intronic
1070578130 10:77696001-77696023 GGCTTAATTGAAATAGAAAATGG + Intergenic
1074510573 10:114108278-114108300 AGAATAGTGTAAATAGAACAAGG - Intergenic
1075912303 10:126135188-126135210 GGCTTAATGTAAATCTTAAAGGG - Intronic
1078326778 11:10387696-10387718 GGGTTAATGAAAATAAAACTTGG + Intronic
1078483672 11:11702606-11702628 TGGTTAATGTAAACAGAAAAGGG - Intergenic
1078796945 11:14601569-14601591 GGCTTAATGTAAATAGAACAAGG + Intronic
1081099470 11:38984339-38984361 GGCTGAATGTAAATGGAAGAAGG + Intergenic
1081245502 11:40761668-40761690 TGCTTAATGAAAATATAACTTGG - Intronic
1081894861 11:46576769-46576791 AGCTTCATGTAAATGCAACATGG + Intronic
1086128240 11:83372008-83372030 GGCTTTATGTAAATTAAATATGG - Intergenic
1086137268 11:83454477-83454499 GGCTAAATGTCAATATGACAAGG + Intergenic
1086475930 11:87173985-87174007 TGCATAAAGTAAATATAACAAGG + Intronic
1088125233 11:106416322-106416344 GACTTACTGCAAATAGACCAAGG + Intergenic
1089021603 11:115221167-115221189 GGCTTAATGTCATTATAAAATGG + Intronic
1089865123 11:121624934-121624956 GTGGTAATGTAAAAAGAACAAGG + Intronic
1090304642 11:125680690-125680712 GGCTTCAGGTAAATACAAAAGGG - Intronic
1093174211 12:15893360-15893382 GGCATAATTTAATAAGAACACGG - Intronic
1093197219 12:16143706-16143728 GAATAAATGTAAATAAAACAGGG + Intergenic
1093244334 12:16717443-16717465 GGCTTAATGTAACCAGGACCTGG + Intergenic
1093785818 12:23190844-23190866 GGATCAACGTAAATTGAACATGG + Intergenic
1094191198 12:27700208-27700230 GGCTCAATGGAAAGAAAACAGGG - Intergenic
1096826993 12:54287213-54287235 GGTTTAATGAAAATAGAAATGGG + Intergenic
1098919434 12:76290285-76290307 GGCATAATATAAACAGAATAGGG - Intergenic
1099640089 12:85275680-85275702 GGCTTATTGTAAGTAGAGCAAGG - Intergenic
1099956607 12:89357158-89357180 GGCTTAATGTAAAATGTATATGG + Intergenic
1100191911 12:92201998-92202020 GGCTTAGTGAAAAGACAACAGGG + Intergenic
1102791442 12:115649726-115649748 GTCTTAATGCAAATGGAAGATGG - Intergenic
1103540660 12:121664181-121664203 GGCTTAATGTCACTGGAACTTGG - Intronic
1107352067 13:39525545-39525567 GGGTTAATGTAAATAGCATGAGG + Intronic
1109021159 13:57094739-57094761 AGCTTAATGTCACTATAACAAGG + Intergenic
1109531500 13:63654595-63654617 GGCTTAATGGAAATAAATAAAGG - Intergenic
1109689696 13:65869700-65869722 GTCTTAAAGTTAATAAAACAGGG - Intergenic
1109925883 13:69138069-69138091 GTATTAGTGGAAATAGAACATGG + Intergenic
1110102641 13:71628798-71628820 GGCATAAGATAAAGAGAACATGG - Intronic
1111185501 13:84728943-84728965 GGGTTAATGTAAATATAAGGTGG + Intergenic
1113335813 13:109374636-109374658 GGGGTCCTGTAAATAGAACAGGG - Intergenic
1115418512 14:33165529-33165551 TGCGTAGTGTAAATAAAACAAGG + Intronic
1115964696 14:38874706-38874728 GGATTAATGTCATTAGAAAAAGG - Intergenic
1117696193 14:58366299-58366321 GGATTAATGTTAATAAAATAAGG + Intronic
1120547334 14:85828023-85828045 GGCCTCATGTAAAAAGAAAATGG - Intergenic
1121720445 14:96105220-96105242 GGCAGAATCTAAAGAGAACAAGG - Intergenic
1125256715 15:37772420-37772442 TGCCTAATGAAAATAAAACATGG + Intergenic
1126840139 15:52709831-52709853 TGCCTACTGTAAATAGAGCAAGG + Intergenic
1127954506 15:63841454-63841476 GGCTTAATGACAATAGGACCTGG + Intergenic
1129494529 15:75965351-75965373 GGGTTTATGCAAATAGAAAAAGG + Intronic
1133637369 16:7680968-7680990 AGCTTAATGCAAAGAGACCAGGG + Intronic
1137496801 16:48975817-48975839 GGCTGAATGGAATTAAAACAAGG + Intergenic
1137501723 16:49016743-49016765 AGCTTAATGTAATCAGTACATGG + Intergenic
1140049433 16:71467150-71467172 TGCTTAAAGTACATACAACAGGG + Intronic
1140672573 16:77293508-77293530 GGGTAAATCTAAATAGTACATGG - Intronic
1145806274 17:27734471-27734493 TGATTCATGTAAATAGAAAATGG + Intergenic
1146154039 17:30504561-30504583 TGATTCATGTAAATAGAAAATGG + Intronic
1149325310 17:55523784-55523806 GGCTTCATATAAATAGAGCCAGG - Intergenic
1152983551 18:301914-301936 GGTTTAAAGTAAACAGGACATGG - Intergenic
1153458835 18:5311459-5311481 GGCTTAATGTGAGCAGATCAGGG - Intergenic
1156428942 18:37049439-37049461 GGTTTACTGTAAAAAAAACAAGG - Intronic
1156562888 18:38148695-38148717 TGCAATATGTAAATAGAACAGGG - Intergenic
1158255821 18:55547363-55547385 GTTTTATTGTAAATATAACATGG - Intronic
1160103236 18:75944118-75944140 GGCTTATTCCAAATGGAACATGG + Intergenic
1162696123 19:12477291-12477313 GGCTCAATATAAATTGAACAGGG - Intronic
1163869947 19:19812336-19812358 GGCTGATTCTAAATAGAAAATGG + Intronic
1163895915 19:20059004-20059026 GGCTGATTCTAAATAGAAAATGG + Intergenic
1163912734 19:20211603-20211625 GGCTGATTCTAAATAGAAAATGG + Intergenic
1163930410 19:20385153-20385175 GGCTGAATGTAAATGGAATAGGG - Intergenic
1163970368 19:20787868-20787890 GGCTGATTCTAAATAGAAAATGG - Intronic
1163994264 19:21028468-21028490 GGCTGATTCTAAATAGAAAATGG - Intronic
1164007118 19:21160535-21160557 GGCTGATTCTAAATAGAAAATGG - Intronic
1164015126 19:21249077-21249099 GGCTGATTCTAAATAGAAAATGG + Intronic
1164028021 19:21371229-21371251 GGCTGATTCTAAATAGAAAATGG - Intronic
1164044532 19:21524639-21524661 GGCTCATTCTAAATAGAAAATGG - Intronic
1164102408 19:22068831-22068853 GGCTGATTCTAAATAGAAAATGG - Intronic
1164317204 19:24101682-24101704 GGCTGATTCTAAATAGAAAATGG - Intronic
925642608 2:6000624-6000646 GCTTTAAAGTAAATAAAACAAGG - Intergenic
930328556 2:49952719-49952741 GGCTTAATGAGAAGAGAGCAGGG - Intronic
930490920 2:52070687-52070709 GGGTTAATCTAAAGAGAAAATGG - Intergenic
930979318 2:57503477-57503499 GGATTAAAGGAAATAGAAAATGG + Intergenic
932951470 2:76299190-76299212 GTCAAAATGTAAATAAAACATGG - Intergenic
934517422 2:94997586-94997608 GGCTAAGTGTAATTACAACAAGG + Intergenic
936975821 2:118221319-118221341 GGCTCTATGTTACTAGAACATGG + Intergenic
937374553 2:121326805-121326827 GGCTTAATGTCATTAAAAAATGG - Intergenic
937621268 2:123990465-123990487 GGCCTAAGGTAAATTGAAAATGG + Intergenic
937971060 2:127549828-127549850 GGCTGAAAGAGAATAGAACAAGG + Intronic
939841294 2:147190640-147190662 GGCTGAAAGTAAAAAGAAAAAGG + Intergenic
941403074 2:165055758-165055780 TGCTTAGTGAAAATAGAACACGG + Intergenic
942746367 2:179238177-179238199 GACTCAATGTAAAGACAACAAGG - Intronic
942971036 2:181958152-181958174 GGCTTAATGGAAGCAGAACAGGG + Intronic
943043584 2:182831956-182831978 TGCTTAATATAAACAAAACACGG - Intergenic
943247882 2:185478426-185478448 GGTGTAAAGTAAATAGAAAATGG + Intergenic
943534723 2:189133689-189133711 GGCCTAATGTAAATTGAGAAGGG + Intronic
945523236 2:210855322-210855344 GTCTTCGAGTAAATAGAACATGG - Intergenic
1169874360 20:10280670-10280692 GGCTTAATTTACATAGCCCAAGG - Intronic
1170051869 20:12155116-12155138 GGGTCACTGTAAATTGAACAAGG - Intergenic
1175087708 20:56474134-56474156 GGCTGAATGTAACCTGAACAAGG - Intronic
1177822479 21:26046463-26046485 GTCTTAATGAAAATAAGACACGG + Intronic
1182387234 22:29954903-29954925 GGCTTATGGTAACTAGAAAAAGG - Intronic
1183955219 22:41376008-41376030 GGCTTACTGAAAATGGGACATGG - Intronic
949275950 3:2281396-2281418 GGCTTAAAATAAATAGGCCATGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
953012297 3:39038940-39038962 GGCTGAAAGTAAAAGGAACATGG - Intergenic
955012560 3:55032712-55032734 GGCTTGATGTGAATATTACAAGG + Intronic
957519277 3:81297558-81297580 GGCTTATTGGAAATAGAAATGGG - Intergenic
957866707 3:86034605-86034627 GGTTTAATGTAATCAGTACACGG - Intronic
959197096 3:103198103-103198125 GAACTAATGAAAATAGAACAGGG + Intergenic
960196864 3:114779168-114779190 GTGTTAAAGCAAATAGAACAAGG - Intronic
960294270 3:115924242-115924264 GGCCTAAGGTAATTAGAATAAGG - Intronic
960618227 3:119615299-119615321 GACTGAGTGGAAATAGAACATGG - Intronic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
965080733 3:164028009-164028031 GAATTGATGTAAATAGACCAAGG - Intergenic
965488988 3:169313723-169313745 AGGTTAAGGTAAATAGAAGAAGG + Intronic
965841053 3:172906159-172906181 GGCTTAAAGTAAATAGAAAAAGG - Intronic
966648536 3:182273435-182273457 TTTTTAATGTATATAGAACATGG + Intergenic
967735707 3:192949930-192949952 GGCTTAAGGAAAATAGTACCTGG - Intergenic
970725445 4:19038714-19038736 TGCTTAATGTAAAGAGCATATGG - Intergenic
971093727 4:23374186-23374208 AGCTCAATGTCAATAGAACTAGG - Intergenic
971404794 4:26312468-26312490 GGGTTGATGTACATAGAATAGGG - Intronic
972234666 4:37117208-37117230 GACTAAATGTAAACAGAAGAAGG + Intergenic
972400484 4:38697531-38697553 CGTTTAATGTAATAAGAACAAGG + Exonic
973796552 4:54433165-54433187 TGCTTCATGTAAACAGAAAATGG - Intergenic
975720092 4:77240857-77240879 GGGTTAATGTAAATGGAAAATGG + Intronic
976190633 4:82483425-82483447 GTCTTACTGTAAATAGTCCAAGG - Exonic
976680548 4:87751104-87751126 GCCCCCATGTAAATAGAACAAGG - Intergenic
978269155 4:106868109-106868131 TGCTGAATCTAAATAGAATACGG - Intergenic
978993831 4:115124583-115124605 GTCTTAATTTTAATAGAAAATGG - Intergenic
980733525 4:136851646-136851668 GGCCATATCTAAATAGAACATGG + Intergenic
980851701 4:138390038-138390060 TCCTTAATGTTATTAGAACAAGG + Intergenic
982900408 4:160992510-160992532 GTATTTATGTAAAGAGAACAAGG + Intergenic
984173928 4:176392963-176392985 GGCTTAATCTTTATTGAACAAGG - Intergenic
986527144 5:8691781-8691803 ACCTAAATGTAAATATAACATGG - Intergenic
986649327 5:9948160-9948182 GGTTTGATATAAATAGCACAGGG - Intergenic
991409768 5:66334329-66334351 GGCTTAATGCTAATAGGTCAAGG - Intergenic
993866108 5:93197789-93197811 GTCTTCATGTACATAAAACAAGG - Intergenic
994025861 5:95082517-95082539 GGCTGAAACTAACTAGAACAGGG + Intronic
996315265 5:122153892-122153914 GGTTTAATGGACAAAGAACATGG - Intronic
1000580933 5:163034943-163034965 AGCCAAATGTAAATAAAACAAGG + Intergenic
1002361194 5:178672550-178672572 AACTTATTGGAAATAGAACAGGG + Intergenic
1005132880 6:22531444-22531466 GACTAAAAGTAAATAGAATAAGG - Intergenic
1006110494 6:31741680-31741702 GAGTTAATGTAAGTAAAACATGG - Intronic
1008518148 6:52337657-52337679 GGCTTAGAGAAAATAGCACATGG + Intergenic
1008727013 6:54433864-54433886 AGCTTAAAGAAAATTGAACAAGG - Intergenic
1010566944 6:77427717-77427739 GATTTATTGTAAATAGAATAAGG - Intergenic
1010697725 6:78997755-78997777 GGTTTAATGAAAACAAAACATGG + Intronic
1011579312 6:88841531-88841553 GGTTGAATGTAAACAGACCATGG + Intronic
1012096796 6:94972445-94972467 GGATTAATGTAAATATGAAAGGG + Intergenic
1012939060 6:105398623-105398645 TGCTTAGTGTAAGTAGAACCTGG + Intronic
1013758686 6:113490531-113490553 GGCTGAAAGTAAATAGCCCATGG - Intergenic
1014591196 6:123273435-123273457 TGGTTATTGTAAATAGAACTAGG + Intronic
1017202687 6:151773068-151773090 GGGTTAATGGAATTAAAACAAGG + Intronic
1017738882 6:157387199-157387221 AGCTAAATGTAAAAAGAAGAAGG - Intronic
1020367589 7:7396726-7396748 GGCTTAATGGAACAAAAACATGG + Intronic
1020590234 7:10126412-10126434 GGCTAAATGTAATTAAAACCAGG - Intergenic
1023427020 7:40048476-40048498 GGTTTTATGTAAATAAAATACGG + Intronic
1024407397 7:48998391-48998413 GGCTTGTTGTAAATAACACAAGG - Intergenic
1027792893 7:82655809-82655831 TGCTTCAAGTGAATAGAACATGG + Intergenic
1029051649 7:97695452-97695474 AGATTAATGTATATAGCACATGG + Intergenic
1030502195 7:110373661-110373683 GGAATAATGTAGACAGAACAGGG - Intergenic
1032856480 7:135837882-135837904 GCATTTATGAAAATAGAACAGGG + Intergenic
1034735916 7:153429505-153429527 GGATAACTGTAAATAGAGCAGGG + Intergenic
1035093836 7:156335992-156336014 GACTGAATGGAAATAGAATATGG - Intergenic
1036215338 8:6875132-6875154 GTCTAAATGTAAAAAGAAAAAGG + Intronic
1038985222 8:32801631-32801653 GCATTAATGTAAAAAGACCAGGG - Intergenic
1039273347 8:35907197-35907219 TGTTTCATGTAAATAGAATATGG + Intergenic
1043238101 8:77894798-77894820 GGCACCATGTGAATAGAACAGGG - Intergenic
1051087527 9:13367718-13367740 GGGTTATTGTAAATATAAAATGG + Intergenic
1051495178 9:17713577-17713599 AGCTGAATGAAAATACAACATGG - Intronic
1051781738 9:20696238-20696260 GACCTAATGTATATATAACATGG + Intronic
1052028178 9:23598140-23598162 GGCTGAATGTGAATAGAAGATGG - Intergenic
1052102734 9:24469886-24469908 GGCTTAATGTGAATAAAGAAAGG - Intergenic
1187738422 X:22328336-22328358 GGCTTAGGGTAGAAAGAACATGG + Intergenic
1187942611 X:24396588-24396610 GGCTTAATGTAGCATGAACATGG - Intergenic
1194675272 X:96786362-96786384 GGCTTCAGGTAATTAGAACTTGG + Intronic
1195432748 X:104807581-104807603 GGCTTGTGGAAAATAGAACATGG - Intronic
1198014445 X:132594406-132594428 GGATTAATGTAGAAAGAGCATGG - Intergenic
1200826312 Y:7646979-7647001 GAGGTAATGTAAATAGAACAAGG + Intergenic
1200882784 Y:8236496-8236518 AAGGTAATGTAAATAGAACAAGG + Intergenic
1202117673 Y:21487307-21487329 GAGGTAATGTAAATAGAACATGG - Intergenic
1202194552 Y:22285734-22285756 GAGATAATGTAAATAGAACAAGG + Intergenic
1202200903 Y:22346471-22346493 GTGGTAATGTAAATAGAACAAGG - Intronic