ID: 1078798899

View in Genome Browser
Species Human (GRCh38)
Location 11:14623220-14623242
Sequence TTGTTCCTATGGCCATATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078798890_1078798899 21 Left 1078798890 11:14623176-14623198 CCAGCATGTCATTCACAACAGCT 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1078798899 11:14623220-14623242 TTGTTCCTATGGCCATATGGGGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078798899 Original CRISPR TTGTTCCTATGGCCATATGG GGG Intronic