ID: 1078799128

View in Genome Browser
Species Human (GRCh38)
Location 11:14624989-14625011
Sequence CTCAAGCCCAACTGCAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078799128 Original CRISPR CTCAAGCCCAACTGCAGCAA TGG Intronic
900728608 1:4235977-4235999 CTCCAGGCCAACTGCAGCTGTGG - Intergenic
902933571 1:19747899-19747921 CTCCATCCCAGCCGCAGCAAAGG - Intronic
903122640 1:21226200-21226222 CTCCAGTCCAACTGCAGTCAGGG - Intronic
903247732 1:22028483-22028505 CCCTAGCCCAAATGAAGCAAAGG + Intergenic
904345104 1:29862724-29862746 CTCAACTCCAAATACAGCAAAGG - Intergenic
905952073 1:41960241-41960263 CTCAGGACCAACTGCAACCATGG + Intronic
908961698 1:69705712-69705734 CTCAAGCCCAGCTGCTGAAATGG - Intronic
909002445 1:70234745-70234767 AGGAAGCCCAAGTGCAGCAAGGG - Exonic
912280148 1:108304497-108304519 CTAAATCCCAAAGGCAGCAATGG + Intergenic
912288078 1:108389860-108389882 CTAAATCCCAAAGGCAGCAATGG - Intronic
912412597 1:109488916-109488938 CTGAAGGCCAACTCCCGCAAAGG + Exonic
912870396 1:113299288-113299310 CTCAAACCCCACTGCACCAGTGG - Intergenic
914873994 1:151498940-151498962 TCCAAGAACAACTGCAGCAATGG - Intergenic
916268646 1:162917808-162917830 CCCTAGCCCAAGGGCAGCAAGGG + Intergenic
1067879423 10:50030498-50030520 CTCATTCCCAACAGCAGCCAAGG - Intergenic
1067892472 10:50148935-50148957 CTCATTCCCAACAGCAGCCAAGG + Intergenic
1070121074 10:73577933-73577955 CTTCAGCTCAACTGCTGCAAAGG + Intronic
1070742801 10:78913643-78913665 CCCAAGCCCAACCTCAGCATGGG + Intergenic
1071023182 10:81082815-81082837 CCCTAGCCCAAGGGCAGCAAGGG + Intergenic
1072626498 10:97115677-97115699 CTCAACAGCAACTGCAGCACTGG + Intronic
1075572967 10:123558742-123558764 CTCAATCCCACCTGCAGCCTGGG - Intergenic
1076389905 10:130091304-130091326 CTCCAGCATACCTGCAGCAAAGG + Intergenic
1077514690 11:2994439-2994461 CTCAAGACCATTTGCAGTAATGG + Intergenic
1077810078 11:5628054-5628076 CTCAAGCCCAGCAGCAGTCAGGG - Intronic
1078799128 11:14624989-14625011 CTCAAGCCCAACTGCAGCAATGG + Intronic
1078993283 11:16670491-16670513 GTTAAGCCCAAGTGTAGCAAGGG - Intronic
1079993639 11:27273159-27273181 CTCCAGCAGACCTGCAGCAAAGG - Intergenic
1081208045 11:40297802-40297824 CTCAAGTCCAATTTCATCAATGG - Intronic
1081705823 11:45181363-45181385 CTCAAGCCCAACTTGGGCCAAGG - Intronic
1084194674 11:67517766-67517788 CTCAATCCCCAGTGCAGCAACGG + Intergenic
1085445843 11:76600061-76600083 CTCAAAACCACCTGCAGGAAAGG - Intergenic
1086098251 11:83071854-83071876 CGCAAGCCCAGCAGCAGCAGGGG + Exonic
1088391558 11:109320347-109320369 CTCAAGACCAACTATAGCAGTGG + Intergenic
1088618697 11:111660215-111660237 CTCAATCCCAACTTCACAAATGG - Intronic
1090478532 11:127046969-127046991 CCCTAGCCCAACTGCAGAGATGG - Intergenic
1090890386 11:130917796-130917818 CTCTGCCCCAACAGCAGCAATGG - Intergenic
1091417217 12:298431-298453 CTCCAGCACACCTGCAGCAGAGG + Intronic
1092441469 12:8508744-8508766 CCCTAGCCCAAGGGCAGCAAGGG + Intergenic
1093477695 12:19573796-19573818 CTCCAGTCCAAGGGCAGCAAGGG + Intronic
1094295900 12:28904605-28904627 CTCAACCCCAACTGGACCACTGG + Intergenic
1099344453 12:81480667-81480689 CTCAAGCAGACCTGCAGCAGAGG - Intronic
1101251412 12:102939532-102939554 CCCCAGCCCAAGAGCAGCAAGGG - Intronic
1105737995 13:23291929-23291951 CTCAAGCCTAGCTGCTGAAATGG + Intronic
1106426488 13:29635915-29635937 CTCCAGCAGACCTGCAGCAAAGG - Intergenic
1106489997 13:30212532-30212554 CTCAAGCAAAACTCCAGCAAAGG + Intronic
1106770672 13:32958071-32958093 CTCAAGTCCAACTACAGCAGTGG - Intergenic
1107594356 13:41947123-41947145 CTCAACCCCCAATGCAGCATGGG - Intronic
1108235151 13:48395130-48395152 CTCCAGCACACCTGCAGCAGAGG + Intronic
1109188008 13:59292584-59292606 CTCCAGCACACCTGCAGAAAAGG + Intergenic
1112520041 13:100087149-100087171 CCCAACTCCCACTGCAGCAAGGG - Intergenic
1113919853 13:113901060-113901082 CTGAAGTCCAGCAGCAGCAAAGG + Intergenic
1114672134 14:24416973-24416995 CTGAAGGCCAGGTGCAGCAAAGG - Exonic
1118934372 14:70273241-70273263 CTCAGGACCAACTGCAGCAGTGG - Intergenic
1118989792 14:70787545-70787567 CTGATGCCCACCTGCTGCAATGG + Intronic
1119189114 14:72667801-72667823 CTCAATTCCAACTGAAGAAAAGG - Intronic
1120032378 14:79656771-79656793 GTGAAGCACAACTGCAGCCAGGG + Intronic
1120331247 14:83095198-83095220 CTCATGTCTAAATGCAGCAAGGG - Intergenic
1120516266 14:85474682-85474704 CTCAAGAACAACTACAGCACTGG + Intergenic
1120545149 14:85801886-85801908 CCCAAGCCTAACTGCAGGAGAGG - Intergenic
1121123109 14:91388754-91388776 CTCAAGCACACTTGCAGCGAGGG + Intronic
1121530450 14:94649124-94649146 CTCAAGAATAACTGCAGCATGGG - Intergenic
1122150757 14:99724936-99724958 CTCAAGGCCTACTTCAGCAGGGG - Intronic
1123449206 15:20349714-20349736 CTCAATGCCAAGTCCAGCAAAGG - Intergenic
1124143093 15:27094619-27094641 CTCAGGCCCAATTCCAACAAGGG - Intronic
1126301960 15:47207269-47207291 GTCAAGCACAAATGGAGCAAAGG - Intronic
1126433910 15:48616386-48616408 CTCAAGACCAAAAGCAGCAGAGG - Intronic
1130153525 15:81330500-81330522 CTCAGGCCCAACTGGAGCCAGGG - Intergenic
1130724119 15:86420350-86420372 CTCAAGCAGACCTGCAGCAGAGG + Intronic
1131405081 15:92157756-92157778 CAAAAGCCAAACAGCAGCAAGGG + Intronic
1131638754 15:94266618-94266640 CTACCGCCCAACTACAGCAATGG - Intronic
1131812669 15:96188792-96188814 CTCTAGTCCATCTGAAGCAAAGG - Intergenic
1135264299 16:21009525-21009547 CTCTAGCTCAACATCAGCAAAGG - Intronic
1137725746 16:50655472-50655494 CTCAACCCCAACTGCTACCAGGG + Intergenic
1138296229 16:55887559-55887581 CTCAGGCCCTGTTGCAGCAATGG + Intronic
1139160291 16:64497895-64497917 CACATCCCCAACTTCAGCAAAGG - Intergenic
1139923760 16:70474701-70474723 CTCAACCCCACCTGCCACAAGGG - Intronic
1140918528 16:79515701-79515723 TTCATGCCCAAGTGTAGCAAGGG - Intergenic
1141083222 16:81071909-81071931 CTCTAACCCAACTGCAACAGAGG - Intronic
1145850344 17:28087833-28087855 CTAAAGCCCAACTTCATCATGGG - Intronic
1146457180 17:33017261-33017283 CTCCAGCCCAGCTGCAGGAGGGG + Intronic
1146525483 17:33563788-33563810 CCCAAGCCCATCTGTAGCAAAGG + Intronic
1148584697 17:48769094-48769116 CTCCAGCCCAACTGGATCCAAGG - Exonic
1151064077 17:71131248-71131270 CTCCAGCACACCTGCAGCAGAGG - Intergenic
1152339441 17:79716150-79716172 CTCAATGCCAAGTCCAGCAAAGG + Intergenic
1152650205 17:81489025-81489047 CCCAAGCCCCACAGCAACAAGGG - Intergenic
1153725919 18:7955186-7955208 CTCAACGCCAACTCCATCAATGG + Exonic
1157724089 18:49950126-49950148 CTCAAGCCCTCCTCCAGCTAGGG + Intronic
1163532091 19:17855941-17855963 CTTTAGCCCAACTGTAGCACAGG - Intergenic
1163884768 19:19955906-19955928 CCCAAGCCCAACACCAGTAAAGG + Intergenic
1164197102 19:22978742-22978764 CTCCAGCACATCTGCAGCAGAGG + Intronic
1164598950 19:29548396-29548418 TTAAAGCCCAACTGCATCAGTGG + Intronic
925062716 2:905399-905421 CTCACATCCAACTGCTGCAACGG + Intergenic
925712796 2:6758026-6758048 CTCAAGGCCCCCTGCATCAAAGG + Intergenic
925771874 2:7289892-7289914 CTTAATCCCAATTGCAGCCAAGG + Intergenic
925874081 2:8297278-8297300 CTTGAGATCAACTGCAGCAATGG - Intergenic
927458276 2:23276122-23276144 CTCAAGCCAAAGTCAAGCAAAGG + Intergenic
927885287 2:26714476-26714498 CTCAGGCCCAACTGCTGCTGGGG + Intronic
930599094 2:53423581-53423603 CTCCAGTCCAAAGGCAGCAAGGG + Intergenic
931004194 2:57828839-57828861 CTCCAGCAGAACTGCAGCAGGGG + Intergenic
931239199 2:60437586-60437608 GTCAAGCCCAGATGGAGCAAGGG + Intergenic
932335216 2:70927276-70927298 CTCCAGCCCAGCTGCAGGAGGGG - Intronic
933229669 2:79791815-79791837 TTCAAACCCATGTGCAGCAAGGG + Intronic
933413102 2:81950460-81950482 CTCCAGCACACCTGCAGCAGAGG - Intergenic
934659898 2:96137861-96137883 CTCAACCCCAACTGGTGCCAAGG + Intronic
936034014 2:109095545-109095567 TTCAAGACCAACTTGAGCAACGG + Intergenic
936260286 2:110953947-110953969 CTCATGTCCAACTGGAGCAGCGG - Intronic
936480862 2:112883777-112883799 CTCAATTCCAAATGCAGCATGGG + Intergenic
936627237 2:114161636-114161658 CTCAAGCACAACTACAGTAGAGG - Intergenic
938144837 2:128824574-128824596 CTCCAGCCAACCTGCAGCAGAGG + Intergenic
938592225 2:132750734-132750756 CTTAATCCCACCTTCAGCAATGG - Intronic
939942097 2:148362871-148362893 CTCCAGCAGACCTGCAGCAAAGG + Intronic
941387060 2:164866592-164866614 CTCATGACCAGCTGCAGAAACGG + Intergenic
941571409 2:167175392-167175414 CTCCAGCACACCTGCAGCAGAGG - Intronic
942083674 2:172425517-172425539 CTTAAGCCCTGATGCAGCAAGGG - Intergenic
943512413 2:188841510-188841532 CTCCAGCAGAACTGCAGCAGAGG + Intergenic
944292142 2:198019116-198019138 CTCCAGCAGACCTGCAGCAAAGG + Intronic
947076482 2:226350897-226350919 CTCAAGTCCAAATGCAGAGATGG - Intergenic
1169462160 20:5805155-5805177 CTCAAAAACAACAGCAGCAAAGG - Intronic
1169646165 20:7812414-7812436 CTCCAGCAGAACTGCAGCAGAGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171178690 20:23075253-23075275 CTCAAGACCAAATGAAGCAGCGG + Intergenic
1171359589 20:24577642-24577664 CTCAAGCCCCTCTGCATCTACGG - Intronic
1171441496 20:25166827-25166849 CTCCAGCAGACCTGCAGCAAAGG + Intergenic
1175619760 20:60433513-60433535 CTCAAGCCCCAAAACAGCAAAGG + Intergenic
1178428606 21:32499469-32499491 TTCATGCCCATCAGCAGCAAGGG - Intronic
1180375086 22:12084408-12084430 CTCAAGCAAACCTGCAGCAGAGG + Intergenic
1182661624 22:31929205-31929227 CCCAAGCACCACAGCAGCAAGGG + Intergenic
1183564373 22:38602836-38602858 TTCAAGCCCAAATGCAGTAGAGG - Intronic
1184965196 22:47966321-47966343 CTCAATCCCAAGTACAGCATGGG - Intergenic
1185345889 22:50310414-50310436 GTCCAGCCCAACTGCAGCCCAGG - Exonic
949640944 3:6035653-6035675 CTCCAGCAGACCTGCAGCAAAGG - Intergenic
950702239 3:14758511-14758533 CCCCAGACCAACTGGAGCAAAGG + Intronic
954625557 3:52020182-52020204 CTCCAGCCCCACTGCAGCCTGGG - Intergenic
956242029 3:67141671-67141693 CTCCAGCCAACCTGCAGCAGAGG - Intergenic
959509038 3:107189240-107189262 CTCAAGGCCCACTGAAGCAGAGG + Intergenic
959848185 3:111057545-111057567 CTCCAGCAGAACTGCAGCAGAGG + Intergenic
960057116 3:113283725-113283747 CTCAAGCCCAAGTCCCCCAAAGG + Intronic
960763214 3:121096595-121096617 CTCCAGCCAACCTGCAGCAGAGG - Intronic
960773057 3:121216439-121216461 CTCTAGCAAAACTGCAGCAGAGG - Intronic
961532051 3:127545934-127545956 CTCAAGCCCACCTCAAGCAGAGG - Intergenic
962512440 3:136115149-136115171 CTCCAGCACACCTGCAGCAGAGG + Intronic
968111323 3:196049605-196049627 CTCAACCCTAACTGTAGAAAAGG + Exonic
968660304 4:1796020-1796042 CTCAAGCTCAGCTGTAACAAGGG - Intronic
975027655 4:69571913-69571935 CTCAACGCCAACTGAAACAAAGG - Intergenic
975770122 4:77711477-77711499 CTCAGAACCAGCTGCAGCAAGGG + Intergenic
976006902 4:80440437-80440459 CTCCAGCACACCTGCAGCAGAGG + Intronic
976114959 4:81716112-81716134 CTCAAGCAGACCTGCAGCAGAGG + Intronic
977800313 4:101221653-101221675 TTCAAGTCCAACACCAGCAATGG + Intronic
978139164 4:105297846-105297868 CTCCAGCAGACCTGCAGCAAAGG + Intergenic
978271282 4:106893491-106893513 CTCCAGCCCAAGGGCAGTAAGGG - Intergenic
979969509 4:127116415-127116437 CTAAAGAACAACTGCAGCAGCGG - Intergenic
985972693 5:3390926-3390948 CTCAGACCCAGCTACAGCAAGGG + Intergenic
986032691 5:3908899-3908921 CTCAATCCCGTCTGCAGTAAGGG + Intergenic
987524651 5:19031505-19031527 CTCAAACACAACTCCAGTAAAGG + Intergenic
987821379 5:22970686-22970708 CCCTAGCCCAAGGGCAGCAAGGG + Intergenic
991515506 5:67430611-67430633 CACAAGCCCAGCTGCTGAAATGG + Intergenic
992436831 5:76762670-76762692 CTCATCCCCAAATGCAGGAATGG + Intergenic
993246429 5:85458890-85458912 CCCCAGCCCAAGAGCAGCAAGGG + Intergenic
993794582 5:92250155-92250177 CCCCAGTCCAAGTGCAGCAAGGG - Intergenic
996570504 5:124928485-124928507 CTGAAGAGCAACTGCAGCGATGG - Intergenic
998384247 5:141747328-141747350 CTCCAGCCCAGCTGCTGCCATGG - Intergenic
1000118320 5:158174065-158174087 CACATGCCCTACTCCAGCAAGGG + Intergenic
1001025729 5:168222955-168222977 CTCCAGCCCCACTCCAGCCAAGG + Intronic
1001328635 5:170746804-170746826 CTCCAGCCCCACTGCTGCGATGG + Intergenic
1001867486 5:175117847-175117869 CTCTATACTAACTGCAGCAAAGG + Intergenic
1003401555 6:5795101-5795123 CTCAAGTCCAAATGCAACAGGGG + Intergenic
1004028092 6:11838078-11838100 CTCAAGCGGACCTGCAGCAGAGG + Intergenic
1008340061 6:50353487-50353509 CTCAAGCCCAGGTGTAGAAAGGG + Intergenic
1008613914 6:53208072-53208094 CACAAGCCCAGCTGCTGCAATGG + Intergenic
1013750104 6:113395816-113395838 CTCAGGCCCAGCTGCAGCAGTGG - Intergenic
1018123494 6:160659595-160659617 CTCAAGCCCAAGGGCATTAACGG + Intronic
1019476097 7:1245083-1245105 CCCAGGCCCGACTGCAGCACTGG - Intergenic
1020248352 7:6447940-6447962 CTCAAGCGCAAACGCAGCGAGGG + Exonic
1022303334 7:29122254-29122276 CTCAACTCCAAATGCAGCACGGG + Intronic
1023433782 7:40121135-40121157 ATCAAGCTGAACTGCAGCTAAGG + Intergenic
1023611050 7:41971627-41971649 TTCAGGCCCAACTGCAGAAGTGG + Intronic
1023639126 7:42240043-42240065 CTCAGGAGCAACTGCAGGAAAGG - Intergenic
1024996054 7:55273855-55273877 CTGGAGCCCAACTGCAGTGATGG - Intergenic
1026679164 7:72452256-72452278 CTCATTCCCATCTGCAGCAGTGG + Intergenic
1028006088 7:85569881-85569903 CACAAGACCCAATGCAGCAAAGG - Intergenic
1030705542 7:112689421-112689443 CTCCAGCAGAACTGCAGCAAAGG - Intergenic
1032661175 7:133985411-133985433 CACAAGCCCAGCTGCTGAAATGG + Intronic
1033684185 7:143623783-143623805 CTCAAACGCAGCAGCAGCAATGG - Intronic
1033687361 7:143703002-143703024 CTCAAACGCAGCAGCAGCAATGG - Exonic
1033700427 7:143833840-143833862 CTCAAACGCAGCAGCAGCAATGG + Intergenic
1035146282 7:156820931-156820953 CTCAAGGTGAACTGCAGCACAGG + Intronic
1041155164 8:54977772-54977794 CTCCAGCAGAACTGAAGCAAAGG + Intergenic
1041423654 8:57696061-57696083 CTCCAGCAGACCTGCAGCAAGGG + Intergenic
1041730449 8:61056999-61057021 CGAAGACCCAACTGCAGCAACGG + Intergenic
1041783976 8:61610916-61610938 ATCAAGCCCATGTGCATCAATGG + Intronic
1042677923 8:71343209-71343231 TTCAAGCCCAGCTGCTGAAATGG - Intronic
1042850744 8:73213645-73213667 CTCCAGCCCCACTGCAGCCCAGG + Intergenic
1044561302 8:93614939-93614961 CTCACCCCCAACTGCAGAAAAGG + Intergenic
1046031254 8:108786214-108786236 CTCACCCCCGACTGCAGCAAGGG + Intronic
1048700609 8:137084555-137084577 CTCAAGGACAGCTGCAGCACCGG - Intergenic
1050450935 9:5780353-5780375 CTCCAGCCAACCTGCAGCAGAGG + Intronic
1051410656 9:16786667-16786689 CTGAACCCCAACTGCAGAAAGGG + Intronic
1055537775 9:77267422-77267444 CTCCAGCAGACCTGCAGCAAAGG - Intronic
1060670328 9:125463184-125463206 CTTAAGCCCCAGTGCAACAATGG + Intronic
1203537472 Un_KI270743v1:54711-54733 CTCAAGCAAACCTGCAGCAGAGG + Intergenic
1186388927 X:9138695-9138717 CTCCATCCCAACTCCTGCAATGG - Intronic
1186400177 X:9250635-9250657 CTCTAGACCAACTGGAGCATAGG - Intergenic
1186748712 X:12598559-12598581 CTCAACCCCACCAGCAGCATTGG - Intronic
1187863987 X:23707272-23707294 CCCAAGCCCAACTCCAGCCTGGG + Intronic
1188717394 X:33476815-33476837 CCCCAGCCCAAGGGCAGCAAGGG - Intergenic
1189248471 X:39581466-39581488 CCCAAGCTCACCTGCAGCCAAGG + Intergenic
1189721757 X:43927047-43927069 CTCCAGCACACCTGCAGCAGAGG - Intergenic
1191206805 X:57842963-57842985 CTCAAGCAGACCTGCAGCAGAGG + Intergenic
1191627418 X:63283806-63283828 CCCCAGCCCAAGGGCAGCAAGGG - Intergenic
1193311067 X:80011585-80011607 TTCAAGCTCTACAGCAGCAAAGG + Intergenic
1193569945 X:83128995-83129017 CTCCAGTCCAAGAGCAGCAAGGG - Intergenic
1193878836 X:86896739-86896761 CTCCAGCAGAACTGCAGCAGAGG + Intergenic
1194846573 X:98816619-98816641 CTCAGGCCCAACTCCAACATTGG + Intergenic
1194958962 X:100214028-100214050 CTCCAGCAGAACTGCAGCAGAGG - Intergenic
1194964105 X:100267711-100267733 CTCCAGCAGAACTGCAGCAGAGG + Intergenic
1199604125 X:149563205-149563227 CACAAGCCCAACTGCCCCACAGG + Intergenic
1201490978 Y:14540709-14540731 CTCCAGCAGAACTGCAGCAGAGG + Intronic
1201631768 Y:16077748-16077770 CTCTACCCCAACTGCAGTTAAGG + Intergenic