ID: 1078811227

View in Genome Browser
Species Human (GRCh38)
Location 11:14766336-14766358
Sequence CTGAATACTCAGGTTAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078811220_1078811227 29 Left 1078811220 11:14766284-14766306 CCAAAATTATAATTTATGAGGAC 0: 1
1: 0
2: 2
3: 29
4: 257
Right 1078811227 11:14766336-14766358 CTGAATACTCAGGTTAAACATGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078811227 Original CRISPR CTGAATACTCAGGTTAAACA TGG Intronic
900586763 1:3436466-3436488 CTGAATGCTCAGGAGAAACTGGG - Exonic
905001087 1:34670722-34670744 CTGAATATTCAGTTTCACCAGGG - Intergenic
908617844 1:65942855-65942877 CTCAATACTAATTTTAAACATGG - Intronic
909930108 1:81487783-81487805 CTGAATACTCACTTGAAAAATGG + Intronic
910764206 1:90764453-90764475 CTCAATAAGGAGGTTAAACAGGG + Intergenic
913476223 1:119240943-119240965 CTGAAGACTCAGGGAAAAGATGG - Intergenic
915695969 1:157742019-157742041 CTGTATACTTGGATTAAACAAGG - Intergenic
920350734 1:205336417-205336439 CTGCATTCTCAGGCTAAATAGGG - Exonic
922190169 1:223311827-223311849 CTGAGAACTTAGGTGAAACAGGG + Intronic
922226876 1:223653086-223653108 ATGCATAATTAGGTTAAACATGG + Intronic
922772486 1:228194133-228194155 CTGATGGGTCAGGTTAAACAGGG + Intergenic
923300293 1:232633908-232633930 CTGAATACCTAAGTTAAATAAGG + Intergenic
1063857203 10:10268512-10268534 CTGAATAATGATGCTAAACAAGG + Intergenic
1068710677 10:60130163-60130185 CTAAGTACTCAGGCTCAACAGGG + Intronic
1070745603 10:78931879-78931901 CTGAATAAATTGGTTAAACAAGG - Intergenic
1071536220 10:86433546-86433568 CTGCACACAAAGGTTAAACAGGG + Intergenic
1071817029 10:89242639-89242661 CTGTAGACTCAGGTTCCACAAGG + Intronic
1075342024 10:121654684-121654706 TTGTATACACAGGTTCAACATGG + Intergenic
1075656831 10:124167555-124167577 TTGAATACTCAGGTAAGACTTGG + Intergenic
1076736777 10:132462528-132462550 CTGGAGACCCAGGTAAAACAAGG - Intergenic
1078811227 11:14766336-14766358 CTGAATACTCAGGTTAAACATGG + Intronic
1081827254 11:46067960-46067982 TTGAAGACTCAGCTTAAGCAAGG - Intronic
1097832192 12:64237017-64237039 TTGAATACAGAGGTTAAAGAAGG - Intergenic
1098181864 12:67855810-67855832 CTGAGGACACAGGGTAAACAAGG - Intergenic
1101698293 12:107147640-107147662 GTGAATAAACAGGTAAAACAAGG - Intergenic
1103436067 12:120926216-120926238 CTGACTTCTCAGGTGAGACAAGG + Intergenic
1103499563 12:121390672-121390694 TTGCAAACTCAGGTTAAGCAGGG - Intronic
1103499747 12:121392267-121392289 TTGCAAACTCAGGTTAAGCAGGG + Intronic
1104697743 12:130876828-130876850 CTGAAAACTGTGGGTAAACATGG - Exonic
1106031993 13:26012473-26012495 CTGAACACTCGGGTTGCACAAGG - Intronic
1108628983 13:52262224-52262246 CTGGATACTCTGATTAAAAATGG + Intergenic
1108778514 13:53797590-53797612 GTGATAACTCAAGTTAAACATGG + Intergenic
1109331741 13:60939638-60939660 CTGACTATTCATGTAAAACATGG - Intergenic
1113047734 13:106173844-106173866 CTTAATACTCAAGTCACACAGGG - Intergenic
1115117645 14:29901844-29901866 CTTAATAATCTTGTTAAACAGGG - Intronic
1117061856 14:51971830-51971852 ATGAATACTCAGGGTCAACTGGG - Intronic
1118923246 14:70168805-70168827 ATGAAGATTCAGGTTATACATGG - Intronic
1127718552 15:61675893-61675915 ATGAATACTCAGGTGTCACATGG + Intergenic
1128338945 15:66806543-66806565 ATAAAAACTCAGGCTAAACATGG + Intergenic
1128904418 15:71454343-71454365 CTTAATACTTAAGTTAAACAAGG + Intronic
1135081488 16:19440077-19440099 CTGAATAGTCAGGGTAATCTGGG - Exonic
1139156180 16:64445516-64445538 TTTAATACTCAGGTAAAAAAGGG - Intergenic
1139318811 16:66096352-66096374 CTGAGTACTCTGGGTAAAGATGG - Intergenic
1150348942 17:64426858-64426880 CTGAATACACAGTTTACATAAGG - Intergenic
1157119285 18:44893944-44893966 CTTTATGCTAAGGTTAAACAGGG + Intronic
1161670869 19:5608439-5608461 CTGAATAAACAGGTTATTCATGG + Intronic
1164010362 19:21198175-21198197 CTGAATACTCATAATAAACAGGG + Intergenic
1164639956 19:29817427-29817449 CTGGAAAATCATGTTAAACAAGG + Exonic
1165273116 19:34727179-34727201 TTGATTACTCAGTTTTAACAAGG - Intergenic
1166180807 19:41107252-41107274 TTAAATACTCAAGTTAAAAAGGG + Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
929167611 2:38899378-38899400 TTGAAGCCTCAGGATAAACATGG - Intronic
931090326 2:58878908-58878930 CTGCATACTTAGGTGAACCATGG - Intergenic
931106351 2:59060878-59060900 CTGGAAACTCAGGTAAACCAGGG - Intergenic
932487349 2:72092204-72092226 CTGAGTAATCAGGTTCAAAAGGG + Intergenic
939056126 2:137366449-137366471 CTGAATACACATGTAAAGCAAGG - Intronic
942940921 2:181615772-181615794 GTTAATAATCAGGTTAAACTAGG + Intronic
945427861 2:209729577-209729599 CTGATTTCTTAGGTTAGACATGG + Intronic
1169850404 20:10042845-10042867 CCAAATACTCAGGGTCAACAGGG + Intronic
1173080422 20:39861982-39862004 CTGACTTCTCAGGTTAAAGGTGG - Intergenic
1174364139 20:50046223-50046245 ATGAAGACTCAGGTAAATCAAGG - Intergenic
1177680197 21:24357776-24357798 CTGAATTTTAAGGTAAAACATGG - Intergenic
1184629791 22:45767503-45767525 CTAAAAACTCATTTTAAACATGG + Intronic
1185059005 22:48596068-48596090 CTGAATTAACAGGTTTAACAAGG + Intronic
954889755 3:53914283-53914305 CTGAATACACAATTTAAATATGG - Intergenic
956028651 3:65012017-65012039 AGGAAAACTCAGGTGAAACATGG + Intergenic
958193823 3:90217554-90217576 TTGAATACTCAGCATAAAGAGGG - Intergenic
958417178 3:93888603-93888625 TTGAATACTCAGCATAAAGAGGG - Intronic
970245502 4:14057608-14057630 CTGGATGTTCATGTTAAACATGG + Intergenic
971060077 4:22958102-22958124 CTGAGGACTCTGGTTAAACATGG + Intergenic
971928498 4:33047225-33047247 ATGTAAACTCAGGTTAAAAATGG + Intergenic
972302955 4:37803102-37803124 TTAAATATTCAGGCTAAACATGG + Intergenic
972475929 4:39449386-39449408 CTGACTACCCAGTTTAAAGAAGG - Exonic
973816681 4:54625908-54625930 CTGAACACTCAAGTACAACAGGG - Intergenic
974926234 4:68301935-68301957 CTGAATACTCTTGAAAAACATGG + Intergenic
975747470 4:77488849-77488871 CTAAATACTTATATTAAACAAGG - Intergenic
975772307 4:77739558-77739580 CTGAATAGTCAGCTAAGACATGG + Intronic
977239249 4:94546841-94546863 TTGAATATTCAGGTTGAAAAAGG - Intronic
977587979 4:98796144-98796166 CTGAATCCTGAGGTGAGACATGG - Intergenic
983141455 4:164154842-164154864 CAGAAGACTCAGGTCACACACGG + Intronic
983143813 4:164187976-164187998 CAGAATACTCAGATTGAACATGG + Intronic
989487354 5:42007562-42007584 CTGGGTACTCAGATTAATCAAGG - Intergenic
991482061 5:67091006-67091028 CTGAATATTCAGGATAAACTCGG + Intronic
993448743 5:88047303-88047325 ATGAATAAACAGGTTAAATATGG + Intergenic
994192472 5:96883538-96883560 ATTCATACTCAGGTCAAACAAGG - Intronic
997018535 5:129967084-129967106 GTGAATTCTGATGTTAAACAAGG - Intronic
997967053 5:138366278-138366300 CTCAAAACTCAGTTTAAATAGGG - Intronic
998831153 5:146160755-146160777 CTAAATATTCAAGTTAAACTTGG + Intronic
1001199291 5:169701443-169701465 CTGAAGTCTCAGGTAAAGCATGG - Intronic
1003432998 6:6057443-6057465 TTGAATAATCCTGTTAAACATGG + Intergenic
1005818432 6:29576698-29576720 ATGATTACTCTGGTTCAACATGG - Intronic
1006800911 6:36759264-36759286 ATGAAACCTCAGGGTAAACAGGG - Intronic
1010356613 6:74941515-74941537 CAGAATGTTCAGTTTAAACATGG + Intergenic
1010698624 6:79011249-79011271 CTGAATACTCAAGTTATGTAAGG + Intronic
1010788192 6:80030181-80030203 CTGATTAACCAAGTTAAACAAGG - Intronic
1013236766 6:108203627-108203649 ATGAATAAACCGGTTAAACATGG + Intergenic
1013550953 6:111207509-111207531 CTGAAGACTTAAGTGAAACATGG + Intronic
1013971867 6:116029876-116029898 CTTAAAAATCAGGTTAAAAAAGG - Intronic
1014600145 6:123401371-123401393 CTTAGTCCTCAGATTAAACAGGG + Intronic
1016829377 6:148418306-148418328 CTGCCTACTCGGGATAAACAAGG + Intronic
1017074881 6:150608767-150608789 CTGAATACTCAGTTGAAATGCGG + Intronic
1023418476 7:39952431-39952453 CTGAATACTGAAGTTAAAAAAGG + Intronic
1026393867 7:69930917-69930939 CTGAATACTCACCTTAAAGATGG - Intronic
1029328794 7:99833831-99833853 CTGAATACTCCTAATAAACAGGG + Intronic
1030475275 7:110024599-110024621 CTTATTACTCAGTTTCAACACGG + Intergenic
1030766261 7:113413472-113413494 CAGAATACCCAGATTAAACATGG - Intergenic
1035251336 7:157599433-157599455 CTGAATACACAGTGTAAAGATGG + Intronic
1035334688 7:158120300-158120322 CTGAATTCTATGCTTAAACATGG + Intronic
1036485979 8:9179036-9179058 CTGAATAGGCAGATTTAACAGGG - Intergenic
1037867096 8:22453512-22453534 TTGAATTCTCAGGTTCCACAGGG - Intronic
1037993046 8:23334000-23334022 CTGAAGAGTTAGGGTAAACATGG - Intronic
1039669112 8:39576618-39576640 CAGAATCCTCAGGTAAGACATGG - Intergenic
1043328958 8:79089453-79089475 CTGAATATTCATGTTCCACAAGG - Intergenic
1043639294 8:82430881-82430903 CTCAATACTAAGGTTTGACAAGG - Intergenic
1044444817 8:92263526-92263548 CTGACTTCTAATGTTAAACAGGG - Intergenic
1050775561 9:9255861-9255883 CTGAATCCTGAAGTCAAACAAGG - Intronic
1055160000 9:73114833-73114855 CTCAATACTCAGATTAACCTGGG - Intergenic
1058205380 9:102099761-102099783 CTGAATACAAAGATTAATCAGGG + Intergenic
1186079720 X:5917292-5917314 CTGCATACTCAGGTAGAACCTGG + Intronic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1188351039 X:29131048-29131070 CTGAATATGCATGTAAAACACGG - Intronic
1190930672 X:54947324-54947346 CTGAATTTTCAGGCTAAATAGGG - Intronic
1195468234 X:105204774-105204796 ATGACTACTCAGGTTCAACCAGG + Intronic
1198682342 X:139196230-139196252 TTGAAGACACAGGTGAAACAAGG + Intronic
1199106239 X:143872548-143872570 CTAAATACACATGTTAAAGATGG + Intergenic