ID: 1078815939

View in Genome Browser
Species Human (GRCh38)
Location 11:14822757-14822779
Sequence TACTTCTTAGGGGTCTGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078815939_1078815946 -9 Left 1078815939 11:14822757-14822779 CCCATACAGACCCCTAAGAAGTA 0: 1
1: 0
2: 0
3: 13
4: 212
Right 1078815946 11:14822771-14822793 TAAGAAGTAGCTGAATTCAGGGG 0: 1
1: 0
2: 1
3: 22
4: 258
1078815939_1078815947 6 Left 1078815939 11:14822757-14822779 CCCATACAGACCCCTAAGAAGTA 0: 1
1: 0
2: 0
3: 13
4: 212
Right 1078815947 11:14822786-14822808 TTCAGGGGTCTGAGCAGCAATGG 0: 1
1: 0
2: 10
3: 31
4: 247
1078815939_1078815948 14 Left 1078815939 11:14822757-14822779 CCCATACAGACCCCTAAGAAGTA 0: 1
1: 0
2: 0
3: 13
4: 212
Right 1078815948 11:14822794-14822816 TCTGAGCAGCAATGGTCTTCAGG 0: 1
1: 0
2: 3
3: 29
4: 212
1078815939_1078815945 -10 Left 1078815939 11:14822757-14822779 CCCATACAGACCCCTAAGAAGTA 0: 1
1: 0
2: 0
3: 13
4: 212
Right 1078815945 11:14822770-14822792 CTAAGAAGTAGCTGAATTCAGGG 0: 1
1: 0
2: 2
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078815939 Original CRISPR TACTTCTTAGGGGTCTGTAT GGG (reversed) Intronic
901461725 1:9395941-9395963 TAAATCTTAAGGCTCTGTATTGG - Intergenic
901860647 1:12072371-12072393 TACTGCGTAGGGGACTGTCTGGG + Intronic
903590250 1:24450152-24450174 TATTTTTTAGAGGTGTGTATAGG + Intronic
905964195 1:42077039-42077061 TACTTGTTATCGGTCTGTTTGGG + Intergenic
906915853 1:50008965-50008987 TACTTGTTATTGGTCTGTTTTGG - Intronic
909051682 1:70774798-70774820 TCTTTCCTAGGGGTATGTATGGG + Intergenic
909083550 1:71145538-71145560 TACTTGTTATTGGTCTGTTTGGG + Intergenic
909167932 1:72252352-72252374 TACTTCTTAAAGGTTTGTCTAGG + Intronic
910331417 1:86076660-86076682 TACTTCTGAGGCCTCTGTTTTGG - Intronic
910385393 1:86677231-86677253 TACTTCTTATTGGTCTGTTTAGG - Intergenic
915844631 1:159251289-159251311 TCTTTCCTAGGGGTATGTATGGG - Intergenic
916275064 1:162985044-162985066 TACTTCTTTGGGTTCCCTATTGG + Intergenic
916794973 1:168158211-168158233 TACTTCTTATTGGTTTGTTTGGG + Intergenic
917221308 1:172731683-172731705 TACTTGTTATTGGTCTGTTTAGG - Intergenic
917338124 1:173946354-173946376 TATTTCTTAGGAGTTAGTATAGG - Intronic
918732612 1:188016793-188016815 TACTTCTTAATCTTCTGTATGGG + Intergenic
920018504 1:202934190-202934212 TACTTCTTACTGGTCTGTCCAGG + Intergenic
921168296 1:212523311-212523333 TAATGCTAAGGGGTCTGGATTGG + Intergenic
921823500 1:219644619-219644641 TACTTGTTATTGGTCTGTTTAGG - Intergenic
921991297 1:221370514-221370536 TACTTTTTAGGGTTCTTTTTTGG + Intergenic
923886310 1:238161014-238161036 TACTTGTTATTGGTCTGTTTAGG + Intergenic
1063155359 10:3374273-3374295 CATTTCTTAGAGGTCTGTAATGG + Intergenic
1065399772 10:25285724-25285746 TACTTCTGAGGTGTCTGTGAAGG - Intronic
1068253491 10:54475547-54475569 TACTGTTTAAAGGTCTGTATAGG - Intronic
1068478582 10:57560714-57560736 TACTTGTTATTGGTCTGTTTAGG + Intergenic
1071058265 10:81536329-81536351 TACTTCTTATTGGTCTGTTCAGG + Intergenic
1073536061 10:104277594-104277616 TACTTCTTAGTGGGTGGTATTGG + Intronic
1074442859 10:113494133-113494155 TTCTTCTTAGGGGTGTGTTGAGG + Intergenic
1077428597 11:2501491-2501513 TACTGCTTAGTGGTCTGTTCAGG - Intronic
1078815939 11:14822757-14822779 TACTTCTTAGGGGTCTGTATGGG - Intronic
1078948839 11:16104855-16104877 TACTTGTTATGGGTCTGTTGAGG - Intronic
1079530511 11:21447053-21447075 TACTACTTGTGGGCCTGTATTGG - Intronic
1079729004 11:23916945-23916967 TACTTCTTACTGGTCTGTTCAGG + Intergenic
1083500226 11:63099077-63099099 TACTTCTTATTGGTCTGTTCAGG - Intronic
1085223759 11:74899718-74899740 TACTTGTTAATGGTCTGTTTAGG - Intronic
1085415347 11:76315805-76315827 TCCTTCTTGGGGGTGTGTTTGGG - Intergenic
1085917445 11:80906488-80906510 TGCTTCTTATTGGTCTGTTTGGG - Intergenic
1086261096 11:84941920-84941942 TACTTCTTATTGGTCTGTTCAGG + Intronic
1087492062 11:98840741-98840763 TACTTTTTATTGGTCTGTTTAGG + Intergenic
1088176633 11:107059950-107059972 GACTTCTTACGCATCTGTATTGG - Intergenic
1088938170 11:114425719-114425741 TACTCCTCATGGGTCTGTAGTGG - Intronic
1089787068 11:120915401-120915423 TTCTTCTGAGATGTCTGTATCGG + Intronic
1091071949 11:132573905-132573927 TACTAGTTATGGGTCTGTTTAGG + Intronic
1094815819 12:34182465-34182487 TACTTGTTATGGGTCTGTTAGGG + Intergenic
1095221030 12:39615122-39615144 TACTTCTTACTGGTCTCTGTGGG + Intronic
1095322107 12:40841246-40841268 TACTTGTTATTGGTCTGTTTAGG - Intronic
1099012516 12:77309041-77309063 CAGTTCTTTGGGGTCTGGATTGG - Intergenic
1099620909 12:85001945-85001967 TGCTTCTCAGTGGTCTGTAAAGG + Intergenic
1102100053 12:110271352-110271374 TACTCTTTTGGGGTCTGGATTGG - Intergenic
1102206029 12:111091426-111091448 CTGTTCTTAGGGGTCTGTACAGG - Intronic
1102663151 12:114547151-114547173 TACTTCTGAGGGCTCTCTCTTGG - Intergenic
1105460202 13:20578391-20578413 TACTTCTTATTGGTCTGTTCAGG + Intronic
1106075101 13:26452752-26452774 TACTTGTTATTGGTCTGTTTAGG - Intergenic
1107091295 13:36483449-36483471 TACTTGTTATTGGTCTGTTTAGG + Intergenic
1107117342 13:36761421-36761443 TACCTTTTAAGGGTCTGAATAGG - Intergenic
1107251672 13:38371019-38371041 TACTTGTTATTGGTCTGTTTTGG + Intergenic
1107743580 13:43480813-43480835 TACTAGTTATGGGTCTGTTTAGG - Intronic
1111297366 13:86298531-86298553 TACTCCTTAGGTATCTGTACTGG + Intergenic
1111348336 13:86994092-86994114 TACTTCCTAGGGGAATGCATGGG - Intergenic
1113212892 13:108003118-108003140 TACTTCCTATGGGTCTGTGGTGG - Intergenic
1113226757 13:108168194-108168216 TCTTTCTTAGGGGTATGTATGGG - Intergenic
1116140590 14:40988571-40988593 TACTTGTTATTGGTCTGTACAGG + Intergenic
1118264212 14:64278961-64278983 TATTTCTTAGGGGTCTTAAAGGG - Intronic
1118717833 14:68572895-68572917 TTCTTCATAGGGTTCTGTCTAGG - Intronic
1119606000 14:76017727-76017749 TACTTGTTAGTGGTCTGTTCAGG + Intronic
1123844943 15:24290423-24290445 TAATTTTTAGGGGTTAGTATAGG + Intergenic
1123860095 15:24457100-24457122 TAATTTTTAGGGGTTAGTATAGG + Intergenic
1124236834 15:27996757-27996779 TACTTCTTATTGGTCTGTTCAGG - Intronic
1127780580 15:62310611-62310633 TACTTCTTATTGGTCTGTTCAGG - Intergenic
1129500129 15:76028452-76028474 TACTTGTTATTGGTCTGTTTAGG - Intronic
1140618642 16:76699280-76699302 TACTTTTGAAGGGTCTTTATAGG - Intergenic
1143257003 17:5565856-5565878 TACTTGTTATTGGTCTGTTTAGG + Intronic
1144276165 17:13670596-13670618 TACTTATTATTGGTCTGTTTAGG - Intergenic
1146081331 17:29783219-29783241 TATTTATTAGGGTTCTCTATAGG + Intronic
1147356271 17:39900077-39900099 TACTTGTTAGTGGTATATATAGG + Intergenic
1148951471 17:51316957-51316979 TTCTTCTAAGGGGTTTTTATTGG - Intergenic
1149111001 17:53030473-53030495 TACTTCCTAGTGGTCTGTTCAGG + Intergenic
1149152701 17:53588288-53588310 TACTTGTTATTGATCTGTATAGG - Intergenic
1153664084 18:7352404-7352426 TACCTCCTGGGGGTGTGTATGGG - Intergenic
1153785193 18:8528382-8528404 TCCTTCCTAGGGGTATGTAGAGG - Intergenic
1157145569 18:45159025-45159047 TACTTCTCAGGGGAAGGTATAGG + Intergenic
1158602989 18:58870787-58870809 TGCTTCTTAGGTGGCTGTCTGGG + Intronic
1160182543 18:76647922-76647944 TCTTTCCTAGGGGTATGTATGGG + Intergenic
1168175204 19:54623337-54623359 TACTTGTTATTGGTCTGTTTAGG + Intronic
925232643 2:2248344-2248366 TACTTGTTATGGGTCTGTTTAGG - Intronic
925269746 2:2595479-2595501 TACTTGTTATGGGTCTGTTCAGG - Intergenic
925886413 2:8397069-8397091 CACATCTTAGGGGCATGTATTGG + Intergenic
927328066 2:21829470-21829492 TGCTTGTTATGGGTCTGTTTAGG + Intergenic
928349731 2:30538844-30538866 TACTTGTTATTGGTCTGTTTGGG - Intronic
928943041 2:36746481-36746503 AACTTGTTAGCGGTCTGTTTAGG + Intronic
929100379 2:38306208-38306230 TACTTGTTATTGGTCTGTACGGG - Intronic
929528653 2:42730883-42730905 TACTTGTTATTGGTCTGTTTAGG + Intronic
930294725 2:49540732-49540754 TACTTGTTATTGGTCTGTCTAGG - Intergenic
930403031 2:50915198-50915220 TATTTCTGAGGTGTCTATATTGG - Intronic
933362029 2:81299212-81299234 TGCTTCTGATGGGTGTGTATTGG + Intergenic
933380033 2:81530703-81530725 TACTTACTAGGTGACTGTATAGG + Intergenic
935356283 2:102203588-102203610 TACTTGTTATTGGTCTGTTTAGG + Intronic
938177581 2:129149192-129149214 TACTTATTATGGGTCTGTTAAGG + Intergenic
941672185 2:168306304-168306326 TACTTGTTATTGGTCTGTTTGGG + Intergenic
941691415 2:168503920-168503942 TGTTTCTTAGGGGTCTGGAGAGG + Intronic
942852934 2:180512058-180512080 TCCTTGTTAGGTGTATGTATAGG + Intergenic
942899614 2:181098757-181098779 TACTTCTTATTGGTCTGTTCAGG - Intergenic
945357904 2:208860592-208860614 TACCACTTTGGGGTCTGGATTGG - Intergenic
945771314 2:214046165-214046187 TACTTGTTATTGGTCTGTTTAGG - Intronic
946277717 2:218643580-218643602 TGCTTCTTAGGGGCCTCTGTGGG + Exonic
1172203465 20:33144473-33144495 TACTTGTTATTGGTCTGTTTAGG + Intergenic
1174283120 20:49453559-49453581 TACTTAGTAGGGGTATCTATGGG + Intronic
1181641761 22:24204513-24204535 ACCTTCTTTGGGGTCTGGATTGG + Intergenic
1185297940 22:50063507-50063529 TACTTCTTCGGGGTTTTTCTGGG + Intronic
1185322875 22:50209888-50209910 TGCTTCTTTGGGGTCTCTACTGG + Intronic
951781405 3:26367227-26367249 TACTTCTTAATAGTCAGTATTGG - Intergenic
951860627 3:27248047-27248069 TACTTGTTATTGGTCTGTTTGGG + Intronic
953763926 3:45718394-45718416 TACTTCTTAGAGGGCAGTAAGGG + Intronic
957754949 3:84472848-84472870 TACTTGTTATTGGTCTGTTTAGG - Intergenic
958067956 3:88569459-88569481 TACTTGTTAGTGGTCTGTTCAGG - Intergenic
959113646 3:102151072-102151094 TACTTGTTATTGGTCTGTTTGGG - Intronic
959305285 3:104656270-104656292 TACTTATTATTGGTCTGTTTAGG + Intergenic
959568259 3:107854905-107854927 TACTCCTTAGTGGACTGTAACGG - Intergenic
959899345 3:111642459-111642481 TGCTTCTTATTGGTCTGTTTAGG - Intronic
959988753 3:112606891-112606913 TGCTTTTTGGGGGTCCGTATAGG - Intronic
960267741 3:115639986-115640008 TACCTCTTTGGGGTCTAGATGGG + Intronic
960685081 3:120287383-120287405 TCTTTCTTAGGGGTATGAATGGG - Intergenic
962373870 3:134844182-134844204 TGCTTCTTAGAGGTCTGTGTGGG + Intronic
962483645 3:135820304-135820326 TACTTTTTATTGGTCTGTTTGGG - Intergenic
962584332 3:136826444-136826466 TACTTGTTATTGGTCTGTCTAGG + Intronic
963052856 3:141157559-141157581 TCTTTCCTAGGGGTATGTATGGG - Intergenic
963056889 3:141193477-141193499 TTTTTCCTAGGGGTATGTATAGG - Intergenic
963310394 3:143704040-143704062 TACTTGTTACTGGTCTGTTTAGG - Intronic
963702705 3:148645824-148645846 AGCTTCTTAGGGGCCTGTAAAGG + Intergenic
965236607 3:166132589-166132611 TACTTGTTAGTGGTCTGTTCAGG + Intergenic
965547270 3:169928812-169928834 TACTTCTTAGGAGTCTTGATAGG - Intronic
966459408 3:180159299-180159321 TACTTATTATTGGTCTGTTTGGG + Intergenic
967503215 3:190223425-190223447 TCCTTCCTAGGGGTATGTACAGG + Intergenic
969834695 4:9831095-9831117 GGCTTCTTAGGGGTCTGTTTGGG + Intronic
971936445 4:33155036-33155058 TACTTGTTACTGGTCTGTTTGGG - Intergenic
972010490 4:34174396-34174418 AACTTGTTATTGGTCTGTATAGG - Intergenic
975463264 4:74679582-74679604 TACTTGTTATTGGTCTGTTTAGG + Intergenic
975674916 4:76817202-76817224 TACTTGTTATGGGTCTGTTCAGG + Intergenic
975918143 4:79348959-79348981 TACTTCTTATTGGTCTGTTCAGG + Intergenic
976970283 4:91094801-91094823 TTCTTCTCAGGGGACTGTAAGGG + Intronic
977026360 4:91823313-91823335 TATTAGTTAGGGGTCTCTATCGG + Intergenic
977644481 4:99397046-99397068 TACTTCTTATTGGTCTGTTCAGG - Intergenic
979594676 4:122521353-122521375 TAATTCTTACTGGTCTGTTTAGG + Intergenic
980885685 4:138759903-138759925 TGCTTCTTAGGGGCCTCTAAGGG - Intergenic
982559420 4:156912160-156912182 CACTTCTTAGAGCACTGTATAGG + Intronic
982667532 4:158284219-158284241 TACTCTTTAGGAGGCTGTATGGG - Intergenic
987213024 5:15703796-15703818 TATTACTTAGGAGTCTGAATTGG - Intronic
988198004 5:28031406-28031428 GACTTCTTATGGGTCTGATTAGG - Intergenic
988597800 5:32610964-32610986 GACTTCTGTGAGGTCTGTATTGG - Intergenic
988698087 5:33644350-33644372 TGCTTCTTAGGGGTGTGTGATGG - Intronic
989005942 5:36812465-36812487 TATTTCTGAGGGCTCTGTTTTGG - Intergenic
989263054 5:39440621-39440643 TACTTCTTAGAAGTCTTAATTGG - Intronic
989693145 5:44169826-44169848 TTTTTCCTAGGGGTATGTATGGG - Intergenic
990335245 5:54765981-54766003 TACCTCTTAGGGGTTTTTATGGG - Intergenic
993243152 5:85416008-85416030 TGTTTCTTAGGGGTATGTACAGG + Intergenic
994226529 5:97258054-97258076 TACTTGTTATTGGTCTGTTTGGG - Intergenic
994311169 5:98272540-98272562 TACTTCTTACTGGTCTGTTCAGG - Intergenic
996245787 5:121262881-121262903 TAAATCTTATGGGTTTGTATTGG + Intergenic
997205226 5:132044194-132044216 TCCTTCCTAGGAGTGTGTATGGG + Intergenic
997584472 5:135036037-135036059 CACTTCTCAGGGGTTTGGATTGG + Intronic
998290892 5:140913262-140913284 TACTTGTTATTGGTCTGTTTAGG + Intronic
1002943325 6:1736768-1736790 TACTTCTAAGGGTTCTATGTAGG - Intronic
1003050305 6:2774673-2774695 TACTTGGTAGGGGTCTGTAGTGG - Intronic
1004766651 6:18736173-18736195 TGTTTCTTATTGGTCTGTATAGG - Intergenic
1004784328 6:18949549-18949571 TACTTCTTATTGGTCTGTTCAGG + Intergenic
1007923956 6:45635960-45635982 TCCTTCTAAGGGGTCTGTGTTGG + Intronic
1007981261 6:46161441-46161463 TATTTCATAGGGGTCTCTCTTGG - Exonic
1011102604 6:83740264-83740286 TATTTGTTATGGGTCTGTTTAGG + Intergenic
1011297563 6:85840523-85840545 TCTTTCCTAGGGGTATGTATGGG - Intergenic
1012251059 6:96981236-96981258 AACTTCTTATTGGTCTGTACAGG + Intronic
1012616241 6:101283154-101283176 TCCTTTCTAGGGGTGTGTATGGG - Intergenic
1013955983 6:115841173-115841195 TGCTTCTCAGGTGTCTGTTTAGG - Intergenic
1014697101 6:124636720-124636742 TACTTTTTATGGGTCTGTTTAGG - Intronic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1017531160 6:155293342-155293364 TACTGCTAAGGTGTCTGCATCGG + Intronic
1018316981 6:162566598-162566620 TACTTGTTATTGGTCTGTTTGGG - Intronic
1018636780 6:165868475-165868497 TACTTTTTACTGGTCTGTTTAGG - Intronic
1019044751 6:169135976-169135998 TACTTGTTATTGGTCTGTTTTGG - Intergenic
1020664217 7:11019417-11019439 TACTTGTTATTGGTCTGTACAGG + Intronic
1020840162 7:13207111-13207133 TACTTATTATTGGTCTGTTTGGG + Intergenic
1022740784 7:33119027-33119049 TACTTGTTATTGGTCTGTTTAGG + Intergenic
1023783029 7:43675961-43675983 TAATTTTTAGGGGTCTGTTAAGG - Intronic
1025073630 7:55923566-55923588 TACATCTTAGGAGTTTGTACTGG - Intronic
1028082702 7:86598795-86598817 TCCTTTTTAGGGGTATGTATGGG - Intergenic
1028152123 7:87386340-87386362 TACTTGTTATTGGTCTGTTTGGG + Intronic
1028339332 7:89698931-89698953 TACTTGTTAGTGGTCTGTTCAGG - Intergenic
1028772526 7:94642612-94642634 TATTTCTTTGGGTTCTGTAATGG - Intronic
1030809690 7:113957868-113957890 TCTTTCCTAGGGGTATGTATAGG + Intronic
1033183711 7:139205654-139205676 TACTTATTATTGGTCTGTTTAGG - Intergenic
1035139389 7:156742576-156742598 TACTTATTAATGGTCTGTTTAGG - Intronic
1037034477 8:14148497-14148519 TACTTCTTATTGGTCTGTTCAGG - Intronic
1038624895 8:29182096-29182118 TACTTATTTGGGGTCTTTCTTGG - Intronic
1040897616 8:52385270-52385292 CCCTTCTTAGGGAGCTGTATAGG - Intronic
1042082196 8:65067021-65067043 TACTTGTTATTGGTCTGTTTAGG + Intergenic
1043116374 8:76258852-76258874 TACTTGTTATTGGTCTGTTTAGG - Intergenic
1043628357 8:82292481-82292503 TACTTGTTATTGGTCTGTTTAGG + Intergenic
1044160187 8:88903589-88903611 TACTTGTTATTGGTCTGTTTAGG - Intergenic
1046759413 8:118005863-118005885 TATTTATTAGGGCTGTGTATTGG - Intronic
1050578324 9:7023315-7023337 TACTTGTTATTGGTCTGTTTGGG + Intronic
1051847762 9:21471543-21471565 TCCTTCTTAGAGGTCTGTTTTGG + Intergenic
1051881431 9:21844193-21844215 TACTTGTTATTGGTCTGTTTAGG - Intronic
1052757462 9:32555717-32555739 CCCTCCTTAGGGGGCTGTATGGG - Intronic
1052955951 9:34253487-34253509 TGCCTCTCAGGGGTCTGTGTTGG - Exonic
1055310145 9:74970725-74970747 TACTTGTTACTGGTCTGTTTAGG - Intergenic
1056570549 9:87810925-87810947 TACTCCTTTGGGTTTTGTATTGG + Intergenic
1058535150 9:105950847-105950869 TTTTTCCTAGGGGTCTGTACAGG + Intergenic
1061122184 9:128650336-128650358 TACTTCTTATGGGGTTGAATGGG - Intronic
1185895836 X:3858097-3858119 CACTTCTCAAGGGTCTGTTTTGG - Intergenic
1185900955 X:3896521-3896543 CACTTCTCAAGGGTCTGTTTTGG - Intergenic
1185906070 X:3934960-3934982 CACTTCTCAAGGGTCTGTTTTGG - Intergenic
1187834970 X:23423225-23423247 TACTTCTGATTGTTCTGTATTGG + Intergenic
1188792886 X:34425596-34425618 TATTTCTGAGGGCTCTGTTTTGG + Intergenic
1188814142 X:34690288-34690310 TACTTGTTATTGGTCTGTTTGGG + Intergenic
1188842761 X:35036827-35036849 TCTTTCCTAGGGGTATGTATGGG - Intergenic
1188869970 X:35360593-35360615 TCTTTCCTAGGGGTATGTATGGG + Intergenic
1189870354 X:45375445-45375467 TACTTATTATTGGTCTGTTTGGG - Intergenic
1191155028 X:57265284-57265306 TCTTTCTTAGGGGTATGTACAGG - Intergenic
1191166345 X:57396018-57396040 TACTTGTTATTGGTCTGTTTAGG + Intronic
1192073954 X:67971410-67971432 TACTTGTTATGGGTCTGTTTAGG - Intergenic
1193596137 X:83447845-83447867 TACTTGTTATTGGTCTGTTTAGG + Intergenic
1193670562 X:84380182-84380204 TACTTGTTATTGGTCTGTTTGGG - Intronic
1193697002 X:84720747-84720769 TACTTGTTATTGGTCTGTTTAGG + Intergenic
1196581940 X:117390509-117390531 TCTTTCCTAGGGGTATGTATGGG - Intergenic
1197402091 X:126005377-126005399 TATTTTTTAGGGGTATGTACAGG - Intergenic
1197564450 X:128064590-128064612 TACTTGTTATTGGTCTGTTTAGG - Intergenic
1201680774 Y:16641845-16641867 TTCTTCTCAGGGGACTGTAAGGG + Intergenic