ID: 1078822561

View in Genome Browser
Species Human (GRCh38)
Location 11:14896418-14896440
Sequence GCCATGGTCCCTGTGTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078822557_1078822561 20 Left 1078822557 11:14896375-14896397 CCTACTAGATTAGATGCTGGGAA No data
Right 1078822561 11:14896418-14896440 GCCATGGTCCCTGTGTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078822561 Original CRISPR GCCATGGTCCCTGTGTTCCT GGG Intergenic
No off target data available for this crispr