ID: 1078823671

View in Genome Browser
Species Human (GRCh38)
Location 11:14906664-14906686
Sequence CTTCAACCCCAAGCGGAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078823667_1078823671 -1 Left 1078823667 11:14906642-14906664 CCCACAGGATGGGACTAAGTGCC 0: 1
1: 0
2: 1
3: 5
4: 97
Right 1078823671 11:14906664-14906686 CTTCAACCCCAAGCGGAACCCGG 0: 1
1: 0
2: 0
3: 1
4: 69
1078823663_1078823671 17 Left 1078823663 11:14906624-14906646 CCTTCATGGTAGACTAGACCCAC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1078823671 11:14906664-14906686 CTTCAACCCCAAGCGGAACCCGG 0: 1
1: 0
2: 0
3: 1
4: 69
1078823668_1078823671 -2 Left 1078823668 11:14906643-14906665 CCACAGGATGGGACTAAGTGCCT 0: 1
1: 0
2: 0
3: 6
4: 150
Right 1078823671 11:14906664-14906686 CTTCAACCCCAAGCGGAACCCGG 0: 1
1: 0
2: 0
3: 1
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078823671 Original CRISPR CTTCAACCCCAAGCGGAACC CGG Intronic
900726211 1:4218012-4218034 CTGCAGCCACAGGCGGAACCAGG - Intergenic
901088880 1:6628559-6628581 CTTCAAGCCCAAGCAGCACACGG + Exonic
902124586 1:14197992-14198014 TTTCAACCCTGAGTGGAACCCGG - Intergenic
908014401 1:59815568-59815590 CTTCACGCCCAAGCGGACCAAGG - Intronic
911606279 1:99909179-99909201 CTTCCACCCCCAGTGGAAGCAGG - Intronic
920350665 1:205335924-205335946 CTTCAAGGACAAGTGGAACCTGG - Intergenic
922665279 1:227463980-227464002 CGTCAACCCCAAGCAGGACAGGG + Intergenic
1063023100 10:2148876-2148898 CTGCATCCCCAAGCAGAAACCGG + Intergenic
1063288040 10:4711946-4711968 CTTCACACCCAATCGGAGCCAGG + Intergenic
1078823671 11:14906664-14906686 CTTCAACCCCAAGCGGAACCCGG + Intronic
1095694831 12:45132643-45132665 CTTCATACCCCAGTGGAACCTGG + Intergenic
1103885042 12:124194068-124194090 CTTCAGCACTAAGCTGAACCAGG - Intronic
1106119126 13:26843687-26843709 TGTCAACCCCAAGATGAACCAGG + Intergenic
1109969990 13:69755262-69755284 CTTCATCCCAAAGCAGAAGCTGG - Intronic
1110408473 13:75177225-75177247 CTTCAACCTCATGAGGGACCAGG + Intergenic
1121841748 14:97140212-97140234 CTTCAACAACAAGTGGGACCAGG - Intergenic
1125227134 15:37408259-37408281 TTTCATCCCCAAGTGGCACCTGG + Intergenic
1126172539 15:45706349-45706371 CTTCAATCCTAAGTGTAACCAGG - Intergenic
1128304423 15:66588699-66588721 CTGCGCCCCCAAGCGGACCCTGG - Intronic
1128760561 15:70213721-70213743 CTTCAACCCCACCCGGAAAGGGG - Intergenic
1128943889 15:71808929-71808951 CTTAGACCCCAAGGGGAAGCGGG - Intronic
1129912673 15:79241332-79241354 CTTCAATCCCAAGCAGATCAGGG + Intergenic
1137871345 16:51953551-51953573 CTTCCACTCCAAGGAGAACCAGG - Intergenic
1143480121 17:7223299-7223321 CTACAACCCCCAGCAGCACCTGG + Intronic
1153900438 18:9614023-9614045 CTCCCTCCCCCAGCGGAACCTGG + Intronic
1162726851 19:12695071-12695093 CTCCCACCCCAAGCCGACCCAGG + Intronic
1162728188 19:12702178-12702200 CTGCAACCCCGAGCGGCCCCGGG + Intronic
1163754397 19:19097845-19097867 CTTCAACCTCATGCGGAGCTGGG - Intronic
930568342 2:53051909-53051931 ATTCAACCCCAAACAGAGCCAGG - Intergenic
932202615 2:69845209-69845231 CTTCGTCCTCAAGCGGGACCTGG + Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
934565674 2:95339235-95339257 CTTCAGCCACAAGGGGAGCCAGG + Intronic
946400815 2:219467528-219467550 CTCCAACCCCGAGGGGAAGCGGG + Intronic
947812280 2:233011978-233012000 CTTGACCCCCAAGGGGACCCTGG + Intronic
948684767 2:239663595-239663617 CTGCTACCCCAAGCAGAGCCAGG - Intergenic
1175712537 20:61232601-61232623 CAGCAAACCCAAGCTGAACCAGG + Intergenic
1175787066 20:61718364-61718386 CTTCAACACCCAGAGGGACCAGG - Exonic
1179564656 21:42239747-42239769 CTTCTGCCCCAACCGGAAGCTGG - Intronic
1179932298 21:44578887-44578909 CTGAAAGCCCATGCGGAACCTGG + Intronic
1181429995 22:22873557-22873579 CTTCAACCCCAAGAGGACTGTGG + Intronic
1182916844 22:34041385-34041407 CTTCAGCCCTAAGCTGAAACTGG - Intergenic
1183780645 22:39996629-39996651 CTTCAGCCTCGAGGGGAACCAGG - Intronic
955114218 3:55981361-55981383 CTTCAACCCCAACAGGAAAAAGG + Intronic
955187136 3:56725185-56725207 CCTCAATGCCAAGGGGAACCAGG + Intergenic
962260219 3:133897340-133897362 CTTCAACCCCAAGCTGGATATGG - Intergenic
966752277 3:183333845-183333867 TTTCAACACCAAAAGGAACCAGG + Intronic
967852040 3:194089576-194089598 GTTCAGCCCCGAGCAGAACCGGG - Intergenic
975182354 4:71361324-71361346 CTTGAACCCCAAGCCATACCAGG - Intronic
983937227 4:173510393-173510415 CTTCAACCCCACTAGGACCCAGG + Intergenic
988597920 5:32612088-32612110 GTTCAACCCCAAGCAAAACAAGG + Intergenic
990342195 5:54834514-54834536 CTTCACCCCCAAGGAGACCCAGG - Intergenic
993044524 5:82852444-82852466 CTTCAGCGCCAAGAGGACCCTGG - Intergenic
993328334 5:86568248-86568270 CTTCAACCCTTAGGGAAACCGGG + Intergenic
1001540129 5:172531974-172531996 CTTCATGCCCAAGCAGGACCTGG - Intergenic
1003501538 6:6707254-6707276 CCTCAAGCCCATGCGGAAGCAGG + Intergenic
1004745804 6:18507966-18507988 CTTCAACCCCAAGAGAAAATTGG - Intergenic
1019492278 7:1321136-1321158 CCTCAGCCCCAGGGGGAACCAGG - Intergenic
1020260210 7:6526744-6526766 CTTCATCCCCAAGAAGCACCGGG - Exonic
1024991137 7:55235297-55235319 CTGCAACCGCAACCGCAACCTGG - Intronic
1029250996 7:99236291-99236313 CTTCAACCCCAAGACGAACTGGG + Intergenic
1032055282 7:128679615-128679637 CTTCTACACCAAGCAGGACCTGG - Intronic
1034347580 7:150396910-150396932 CTTCAGCCAGAAGCCGAACCTGG + Exonic
1035444864 7:158933400-158933422 CTTGAGCCCCATGCAGAACCAGG + Intronic
1045555217 8:103208878-103208900 CTTCAACCCCCAGGAGGACCTGG + Intronic
1049471168 8:142775626-142775648 CTTCAACCCCATGCGCTGCCCGG - Exonic
1056273986 9:84974987-84975009 CTGCAGCCCCAGGCGGCACCAGG - Intronic
1059440935 9:114306459-114306481 CTTGAACCCCAGGCTGGACCAGG + Intronic
1191222432 X:58003512-58003534 CTTCATCCCAAAGGGGTACCTGG - Intergenic
1197511870 X:127379885-127379907 CTTCACCCTCAAGCAGGACCTGG + Intergenic
1200956160 Y:8948407-8948429 CTTCATCTCCAAGGGGTACCTGG + Intergenic
1202133550 Y:21636414-21636436 CTGCAACCCCAAGAGAAACTTGG + Intergenic