ID: 1078825035

View in Genome Browser
Species Human (GRCh38)
Location 11:14921566-14921588
Sequence CTTGACACTTTGGAATACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078825035_1078825039 22 Left 1078825035 11:14921566-14921588 CCAGTGTATTCCAAAGTGTCAAG 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1078825039 11:14921611-14921633 TGAGAAACTGTTAAAGACTCAGG 0: 1
1: 0
2: 4
3: 19
4: 233
1078825035_1078825038 -7 Left 1078825035 11:14921566-14921588 CCAGTGTATTCCAAAGTGTCAAG 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1078825038 11:14921582-14921604 TGTCAAGGTCATGAAAAACAAGG 0: 23
1: 196
2: 423
3: 644
4: 903
1078825035_1078825041 24 Left 1078825035 11:14921566-14921588 CCAGTGTATTCCAAAGTGTCAAG 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1078825041 11:14921613-14921635 AGAAACTGTTAAAGACTCAGGGG 0: 1
1: 0
2: 2
3: 23
4: 273
1078825035_1078825040 23 Left 1078825035 11:14921566-14921588 CCAGTGTATTCCAAAGTGTCAAG 0: 1
1: 0
2: 1
3: 16
4: 153
Right 1078825040 11:14921612-14921634 GAGAAACTGTTAAAGACTCAGGG 0: 1
1: 0
2: 2
3: 27
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078825035 Original CRISPR CTTGACACTTTGGAATACAC TGG (reversed) Intronic
901369041 1:8780545-8780567 CTTGATATTTTGGTATACCCTGG - Intronic
903027685 1:20441293-20441315 CTTGACACAATAGAATAAACTGG - Intergenic
903121522 1:21219580-21219602 TTAAACACTGTGGAATACACTGG - Intronic
906666565 1:47626280-47626302 CATGAAAGTTTGGAATACACTGG + Intergenic
908399577 1:63758439-63758461 CTTGAGACCTTGGAGTACATCGG - Intergenic
911058304 1:93726321-93726343 CTTGACACTTTGGAAGGCCAAGG - Intronic
912824507 1:112893515-112893537 CTTAGCACTTTGGAAGACCCTGG + Intergenic
916886851 1:169077919-169077941 TCTGACACTTTGGAAGACAATGG - Intergenic
920193258 1:204209090-204209112 CTTGACACTTTTGAAGATTCAGG + Intronic
920734465 1:208518302-208518324 GTTGAGAATTTGAAATACACAGG + Intergenic
922031370 1:221802927-221802949 TTTGACAGGTTGGAATACAGTGG + Intergenic
924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG + Intronic
1063234430 10:4098117-4098139 CTAGGCACTTTGGATTCCACTGG - Intergenic
1063545353 10:6975957-6975979 CTTTGCACTTTGGAACTCACAGG - Intergenic
1063830793 10:9950310-9950332 CTTAACATTAAGGAATACACAGG + Intergenic
1064284070 10:13977071-13977093 CTTCTCACTTTGGAATAAATCGG - Intronic
1064970842 10:21065332-21065354 CTTCACACTTTGCAATACTCTGG + Intronic
1068388865 10:56366080-56366102 CTTGACTATTGGGTATACACTGG - Intergenic
1069516408 10:69081117-69081139 CCTGACACTTTGGAAGGCAGAGG - Intergenic
1071913320 10:90260943-90260965 ATTGACACTTTGTATTACAAAGG - Intergenic
1073169901 10:101497448-101497470 CCTGGCACTTTGGAATGCCCAGG + Intronic
1073949453 10:108789692-108789714 GTTGAACCTCTGGAATACACTGG - Intergenic
1075140205 10:119826872-119826894 CTTGAAACTATGGAAAACACAGG + Exonic
1075982974 10:126757031-126757053 CTTGACTCTTTGAAATGCTCTGG - Intergenic
1078156951 11:8807527-8807549 GATGAAACTTTGAAATACACTGG - Intronic
1078199565 11:9168062-9168084 GTTAACACTTTGAAATACAAAGG - Intronic
1078825035 11:14921566-14921588 CTTGACACTTTGGAATACACTGG - Intronic
1079047675 11:17121365-17121387 CTTGACACTTTGGAAGGCTGAGG - Intronic
1086928090 11:92662658-92662680 CTTGACACTTTGGGCTATGCAGG + Intronic
1087026595 11:93655930-93655952 CTGGACATTTTGGAATCAACAGG - Intergenic
1099694705 12:86003049-86003071 CCTGACACTTTGGGAGACAAAGG - Intronic
1099835264 12:87902551-87902573 CTTGATAATTTAGAATACAAGGG - Intergenic
1100776200 12:97977768-97977790 ATTGTCACTTTGGAGTACATGGG + Intergenic
1100840367 12:98606708-98606730 CTTCAAACTTTGCAATACACTGG - Intergenic
1100994509 12:100288938-100288960 CTGGACACTTTGGAGTACCCAGG + Intronic
1105361438 13:19721916-19721938 TTTGGCACTTTGGAAAACATAGG - Intronic
1106602153 13:31197349-31197371 CAGCACACTTTGGAACACACAGG - Intergenic
1108462539 13:50681113-50681135 CTAGAAACTTTGGAACACACGGG + Intronic
1108780089 13:53819674-53819696 CTAGACACTTAGGAACACATGGG - Intergenic
1110427261 13:75382411-75382433 CTTGACACCTTTGCATATACTGG + Intronic
1111185120 13:84724614-84724636 CTGGACACTTGGGATTACATTGG + Intergenic
1112670870 13:101636722-101636744 CCTCACACTGTGTAATACACTGG + Intronic
1114036650 14:18635983-18636005 CTTTGCACTTTGGAATACAGAGG + Intergenic
1114121986 14:19679054-19679076 CTTTGCACTTTGGAATACAGAGG - Intergenic
1114404264 14:22440781-22440803 CTTGACATGATGCAATACACAGG + Intergenic
1120696026 14:87646527-87646549 CTTAACACTTAGGTATCCACAGG - Intergenic
1122681862 14:103470811-103470833 TTTGACACTTAGGACTGCACAGG + Intronic
1123834985 15:24180377-24180399 CTTGACTTTTTTGAAAACACAGG + Intergenic
1124025939 15:25965647-25965669 CTTGAGAGTTTGGAATACATAGG - Intergenic
1127214434 15:56809841-56809863 GTGGCCACTTTGGAAAACACAGG + Intronic
1132075787 15:98818678-98818700 CTGAACATTTTGCAATACACAGG - Intronic
1134111940 16:11520892-11520914 CTAGAATCTTTGAAATACACTGG + Intronic
1134380215 16:13717396-13717418 CTTGAAAGTTTGGGAAACACTGG + Intergenic
1134505258 16:14800538-14800560 CTTGATACTTTTGAAGATACAGG + Intronic
1134575318 16:15328372-15328394 CTTGATACTTTTGAAGATACAGG - Intergenic
1134727127 16:16428120-16428142 CTTGATACTTTTGAAGATACAGG + Intergenic
1134940310 16:18283735-18283757 CTTGATACTTTTGAAGATACAGG - Intergenic
1137276564 16:46938246-46938268 CCTAGCACTTTGGAAGACACAGG - Intergenic
1138827362 16:60336623-60336645 CTTGCCACTTTTGAAGACATAGG + Intergenic
1138851245 16:60632440-60632462 CTTGACATTTTGGTATGCAATGG - Intergenic
1140501509 16:75437496-75437518 ATTGACACTCTGGACTAGACTGG + Intronic
1141544876 16:84759417-84759439 CTTTGCACTTTGGAATACAGAGG - Exonic
1142992242 17:3739170-3739192 GGTGACACTTTGGCACACACTGG - Intronic
1144441318 17:15285298-15285320 CTTCAGATTTTGGTATACACAGG + Intergenic
1145816825 17:27800963-27800985 ATTGACAGTATGGAACACACTGG + Intronic
1147323155 17:39657989-39658011 CTTGACAATGAGGAATGCACTGG - Exonic
1149279243 17:55083912-55083934 CTTGTCACTTTCCCATACACGGG - Intronic
1158229520 18:55238430-55238452 CCTGTCACTTTGGGAGACACTGG + Intronic
1158235148 18:55304037-55304059 CTTAACTCTTTGGATTTCACTGG - Intronic
1159064457 18:63554645-63554667 CTTGATACTCTGGAATAGATTGG + Intergenic
1166432225 19:42737464-42737486 ATGGACACTTTGGGAAACACAGG + Intronic
1166435340 19:42762653-42762675 ATGGACACTTTGGGAAACACAGG + Intronic
1166445209 19:42852684-42852706 ATGGACACTTTGGGAAACACAGG + Intronic
1166471010 19:43079611-43079633 ATGGACACTTTGGGAAACACAGG + Intronic
1166491769 19:43266523-43266545 ATGGACACTTTGGGAAACACAGG + Intronic
1166495748 19:43301914-43301936 ACTGACTCTTTGGAAAACACAGG + Intergenic
926793790 2:16601967-16601989 ATTGAAATTTTGGTATACACAGG - Intronic
927821390 2:26268597-26268619 CTTGACACTTTTGAAGACTGGGG - Intronic
928017578 2:27672675-27672697 ATTGACAGTTTGGAATATATAGG + Intronic
928868569 2:35947843-35947865 CTTGCCACATTGTAATTCACTGG - Intergenic
932004015 2:67909918-67909940 CTTGAGCCTTAGGAATACAGTGG - Intergenic
933071524 2:77864563-77864585 CTTGCCACTCTGGAATGCAGTGG + Intergenic
937249059 2:120511907-120511929 CTTTAGACTTTGGAAGACAATGG + Intergenic
940562987 2:155325342-155325364 CTTCACACTCTGGACAACACAGG - Intergenic
947057895 2:226127891-226127913 CTTGACCCTATGTTATACACTGG + Intergenic
1170700626 20:18700085-18700107 CTTGATACTTCTGAAGACACAGG + Intronic
1172414688 20:34755392-34755414 CTTGTCTCTTTGGAAGAGACAGG + Intronic
1173591369 20:44227667-44227689 CTTGACACCTTACAATAAACAGG + Intergenic
1174388648 20:50202759-50202781 CTTGACACTTTTGAGGATACAGG + Intergenic
1175303309 20:57958419-57958441 CTGGAAACTTGGGAAGACACTGG + Intergenic
1175507925 20:59499383-59499405 CATGACAGTTTGGAACACCCGGG + Intergenic
1175694752 20:61093420-61093442 CTGAACACCTTGTAATACACAGG - Intergenic
1178921831 21:36743824-36743846 CTTGACGGGTTGGAATCCACGGG + Intronic
1180243036 21:46524505-46524527 ATTGTCCCTTTGGAATTCACCGG + Intronic
1180460776 22:15563031-15563053 CTTTGCACTTTGGAATACAGAGG + Intergenic
1182275507 22:29185903-29185925 CTTCCCACTTTGGTTTACACAGG + Intergenic
949745135 3:7282165-7282187 CTTGACAGTTTGGAGAACATGGG - Intronic
949791551 3:7797766-7797788 CTAGGCACTATGGAATACAAAGG + Intergenic
950955014 3:17043378-17043400 CCTGACACTTTTTAGTACACTGG + Intronic
951736038 3:25865789-25865811 CATGACGCTATGGGATACACAGG - Intronic
953366483 3:42349953-42349975 CTTGACACTCTAGAATCCCCTGG + Intergenic
953651761 3:44811937-44811959 GTAGACACTTTGAAATACAAAGG - Intronic
955379075 3:58422279-58422301 CTTGCCAGTTTGGAACACTCTGG - Intronic
955421650 3:58744181-58744203 CATGACCCTGTGGAATACGCAGG + Intronic
962245454 3:133787196-133787218 CTAGATACTTTGTCATACACTGG - Intronic
962502099 3:136005643-136005665 CATGACACATTGCAGTACACAGG + Intronic
964056462 3:152466377-152466399 GTTGAAACTTTGGCATTCACTGG - Intergenic
964498375 3:157320062-157320084 TTTGATACTATGGAATAAACAGG - Intronic
964627495 3:158773188-158773210 CTAGACATTTTGGAAGACAGGGG - Intronic
966375045 3:179287949-179287971 TTTGACACTTTCCAATACAGTGG - Intergenic
966658732 3:182390148-182390170 CTTGCCAATTTGAAATAAACTGG + Intergenic
967986951 3:195102189-195102211 CATGATATTTTGAAATACACAGG + Intronic
968856881 4:3131754-3131776 CTTGACACCACGGAATACCCTGG + Exonic
972051814 4:34744147-34744169 CTTGACACTTTGGGATTCTGAGG + Intergenic
976108838 4:81648665-81648687 CTTTACTCTTTTGAACACACTGG + Intronic
976403149 4:84630687-84630709 CTTGATACTTTGGAAGACCAAGG + Intronic
977889360 4:102290518-102290540 CTTGAAACTCTGGAGTGCACTGG - Intronic
978259122 4:106731715-106731737 ATGGACACATGGGAATACACAGG - Intergenic
978652442 4:111022572-111022594 CATGACACATAGGAAAACACTGG + Intergenic
978740770 4:112135604-112135626 CTGGGCACTTTGTAAAACACAGG + Intergenic
982913285 4:161173248-161173270 CTTGTCACAGTAGAATACACTGG - Intergenic
984791808 4:183621860-183621882 CTTGACATTTTGGACAGCACAGG - Intergenic
985516568 5:348297-348319 CATGACACTGTGGAAGCCACAGG + Intronic
987592422 5:19947438-19947460 CTTGACTCTTTTGAAAATACAGG + Intronic
987934010 5:24440670-24440692 CTAGAAACCTTGTAATACACTGG - Intergenic
988153444 5:27417243-27417265 CTTGACAACTTGGTATACTCAGG - Intergenic
988353051 5:30137091-30137113 CATTACATTTTGGAATAAACAGG + Intergenic
988588862 5:32531494-32531516 CTAGACACTTTGGGATGCAGAGG - Intergenic
989556225 5:42798356-42798378 CCTGAAACTTTGGAATCCCCAGG + Intronic
990633534 5:57697055-57697077 CTTGGCACATTGGTATACAGAGG + Intergenic
992055359 5:72983523-72983545 ATTGTCACTTTGAAAGACACTGG - Intronic
994048032 5:95331078-95331100 CTTGACCCTTTTGATTACATTGG - Intergenic
996146338 5:119981513-119981535 CTTAACACTTTTGATTAGACTGG + Intergenic
999637513 5:153638236-153638258 CTAGACACTGTGGAATAGAGTGG - Intronic
999737018 5:154520690-154520712 CTTGACATTTTGGAGCTCACTGG + Intergenic
1000696210 5:164387411-164387433 CTTGACAATTTGGAAAATAGAGG + Intergenic
1000990320 5:167905215-167905237 CCCGACAGTTCGGAATACACAGG + Intronic
1005092041 6:22067393-22067415 CTTCACACTGTGGGAAACACTGG + Intergenic
1007762541 6:44141474-44141496 CTGGACTCCTTGGAATCCACTGG - Intronic
1010388555 6:75310327-75310349 CTTGACTCAGTGGAATAGACAGG - Intronic
1012758744 6:103267705-103267727 TTTGACACTTTTTAATACAAAGG - Intergenic
1014645652 6:123969204-123969226 CTTGCCATTTTGTAATACAGTGG - Intronic
1015502595 6:133949899-133949921 CTAGAGACTTTGAAAAACACTGG - Intergenic
1015505966 6:133988635-133988657 CTTTCCACTTTGGAATAAGCAGG - Exonic
1017226253 6:152024948-152024970 TTAGACACTTTGGAATAGAAAGG - Intronic
1021695699 7:23273932-23273954 ATTGACAGTTTGCAAGACACTGG - Intronic
1022047837 7:26637273-26637295 CCTGACACTTTGGAAGAAAATGG - Intergenic
1022929063 7:35091601-35091623 TTTGTCACTTTGGAAAAAACTGG + Intergenic
1029489101 7:100860730-100860752 ATTGACACTTTGGGGTGCACTGG + Intronic
1029489159 7:100861037-100861059 ATTGACACTTTGGGGTACACTGG + Intronic
1030042350 7:105463337-105463359 GTTGACGCTTTGGAACACAGTGG + Intronic
1030340192 7:108370241-108370263 CTTGAAACTTTGGAAAACATTGG - Intronic
1032880088 7:136079862-136079884 CTTAACACTTTGGCATGAACTGG + Intergenic
1033250822 7:139757402-139757424 CTAGACACTTTGGGAGGCACTGG + Intronic
1035818417 8:2565181-2565203 CTTGAAACTTTGGAGACCACAGG + Intergenic
1036595708 8:10210150-10210172 CTTGACTCTTTGGGATACATTGG + Intronic
1036692176 8:10951037-10951059 CTTGACAATTTGGAAAGCACAGG - Intronic
1037474105 8:19239276-19239298 CATGACACTTTGGAAAACACAGG - Intergenic
1038272323 8:26085343-26085365 CTTCAGACTTTGGATTTCACTGG - Intergenic
1040468347 8:47715913-47715935 GTAGCCACTTTGGAAAACACTGG - Intronic
1040910727 8:52515997-52516019 GTTGACAATTTGGAATTTACGGG - Intergenic
1044991801 8:97802878-97802900 TTTGACAATTTGGAAAATACAGG + Intronic
1046098512 8:109587928-109587950 GTTGACTCTAAGGAATACACTGG + Intronic
1046803955 8:118459818-118459840 CAAGGCACTTTGGGATACACTGG + Intronic
1047348935 8:124054905-124054927 CTTGCCCCTTCGGAATACACTGG - Intronic
1059904513 9:118967406-118967428 TCTGACACTATGGAATACTCTGG - Intergenic
1189240627 X:39521891-39521913 CTGGACACTTTTGAATACTGAGG - Intergenic
1194261462 X:91700469-91700491 CTCTAGATTTTGGAATACACAGG - Intergenic
1194995466 X:100587192-100587214 TTTGACACTTTGCAATAAAAAGG - Intronic
1195755253 X:108193281-108193303 TTTGATACTATGGAATACTCAGG - Intronic
1200580113 Y:4939279-4939301 CTCTAGATTTTGGAATACACAGG - Intergenic