ID: 1078827307

View in Genome Browser
Species Human (GRCh38)
Location 11:14941526-14941548
Sequence CTGGCCTGACTGATGTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078827307_1078827311 -3 Left 1078827307 11:14941526-14941548 CCACCTTACATCAGTCAGGCCAG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1078827311 11:14941546-14941568 CAGTGAAATGGCTCTTGAAAAGG 0: 1
1: 0
2: 0
3: 25
4: 257
1078827307_1078827314 29 Left 1078827307 11:14941526-14941548 CCACCTTACATCAGTCAGGCCAG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1078827314 11:14941578-14941600 GTTCCCTTGTTGCCAAATCCAGG 0: 1
1: 0
2: 0
3: 10
4: 135
1078827307_1078827313 7 Left 1078827307 11:14941526-14941548 CCACCTTACATCAGTCAGGCCAG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1078827313 11:14941556-14941578 GCTCTTGAAAAGGTCACTAAGGG 0: 1
1: 0
2: 5
3: 16
4: 138
1078827307_1078827312 6 Left 1078827307 11:14941526-14941548 CCACCTTACATCAGTCAGGCCAG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1078827312 11:14941555-14941577 GGCTCTTGAAAAGGTCACTAAGG 0: 1
1: 0
2: 1
3: 11
4: 123
1078827307_1078827315 30 Left 1078827307 11:14941526-14941548 CCACCTTACATCAGTCAGGCCAG 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1078827315 11:14941579-14941601 TTCCCTTGTTGCCAAATCCAGGG 0: 1
1: 1
2: 0
3: 19
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078827307 Original CRISPR CTGGCCTGACTGATGTAAGG TGG (reversed) Intronic
900325621 1:2107430-2107452 CTGGGCTGACTGATGCATGTGGG + Intronic
902841486 1:19076958-19076980 ATGGCCTGACTGACTTGAGGCGG - Intronic
904469463 1:30727450-30727472 CTAGCCTGACTGATAAAAGAAGG - Intergenic
906955649 1:50371541-50371563 CTGGGCTGACTGGAGGAAGGTGG - Intergenic
906974526 1:50555558-50555580 CTGTTCTTACTGGTGTAAGGTGG - Intronic
907314098 1:53557462-53557484 CTGGCTAGATGGATGTAAGGAGG + Intronic
911381272 1:97118180-97118202 CTGACCTTGCTGATGCAAGGGGG + Intronic
913490454 1:119374876-119374898 CTCTCCTGACTGAGGGAAGGAGG - Intronic
920165651 1:204033857-204033879 CTGGCTTTGCAGATGTAAGGAGG - Intergenic
921372203 1:214435705-214435727 CCATTCTGACTGATGTAAGGTGG - Intronic
922532001 1:226351788-226351810 CTGGGCTGACTCAAGTAAAGAGG + Intergenic
1062773794 10:127968-127990 GCGGACTGACTGATGGAAGGAGG + Intergenic
1062943968 10:1445800-1445822 CTGACCTGTGTGATGGAAGGAGG + Intronic
1062991898 10:1827128-1827150 CTGCCTTGACTGATAGAAGGTGG + Intergenic
1067360595 10:45574586-45574608 CTGGCTTGACTGAGGTGATGGGG - Intronic
1067424710 10:46197861-46197883 CTGGACTGACTGATATAGGCTGG - Intergenic
1068345362 10:55770863-55770885 CTGGACTGACTGATATAGGCTGG + Intergenic
1068697724 10:59985946-59985968 CTGTACTGACTTATGTAAGTAGG + Intergenic
1070777471 10:79118240-79118262 ATGGGCTGACTGAAGTCAGGAGG - Intronic
1072056583 10:91764266-91764288 CTATTCTGACTGATGTAAGATGG - Intergenic
1072610226 10:97012879-97012901 CTGGCCTGACTGGTGGAATGGGG + Intronic
1078827307 11:14941526-14941548 CTGGCCTGACTGATGTAAGGTGG - Intronic
1079276730 11:19045417-19045439 CTGTTCTGACTGGTGTGAGGTGG - Intergenic
1079454186 11:20622937-20622959 CTGGCCTCACAGCTGTCAGGTGG - Intronic
1080557338 11:33429716-33429738 CTGGCCTGAACAATGGAAGGAGG - Intergenic
1080654886 11:34251118-34251140 CTGGCCTGGCTGTTGTAAAGGGG + Intronic
1082651520 11:55799787-55799809 CTATCCTGACTGGTGTTAGGTGG - Intergenic
1084277920 11:68065056-68065078 CTGTCCTGAATGATGGGAGGAGG - Intronic
1084975085 11:72792674-72792696 CTGGCCTGGCTGATGAGAAGGGG - Intronic
1085477033 11:76795314-76795336 CTGGTCTGGCTGAAGTGAGGGGG - Intronic
1085772402 11:79337242-79337264 CTGCCCTGACCAATGTAATGTGG - Intronic
1087393237 11:97566269-97566291 CTGGCCTCCATGATTTAAGGTGG - Intergenic
1089108443 11:116035149-116035171 CTGGCCTGTCTCATGGGAGGTGG + Intergenic
1095943408 12:47740453-47740475 CTGGCCTGGCTGTTGTCTGGGGG - Intronic
1095998828 12:48112452-48112474 TGGGCCTGACTGAAGTAATGGGG + Intronic
1096629502 12:52916831-52916853 TAGGACTGACTGATGCAAGGAGG + Intronic
1097398774 12:59105214-59105236 TGGGCCTGACTGAAGTAATGGGG - Intergenic
1098611216 12:72460523-72460545 CTGGCCAGACTGATTTAGGCTGG - Intronic
1099325123 12:81205188-81205210 CTGGCATGACTGAAGTTTGGAGG - Intronic
1100751471 12:97702902-97702924 CATGCTTGACTGAAGTAAGGAGG + Intergenic
1101057806 12:100937233-100937255 CTGTCTTGACTGATGTACAGAGG - Intronic
1101715090 12:107303995-107304017 CTGTCCTGAGTGATTTAAGCAGG + Intergenic
1103929234 12:124440399-124440421 GCGGCCAGACTGATGGAAGGTGG - Intronic
1105022204 12:132824344-132824366 CTGGCCTGTAGGATGCAAGGTGG - Intronic
1110591817 13:77271862-77271884 CTGGCCTGACTGTTGGTAGAGGG - Intronic
1113095296 13:106657282-106657304 CTCGTCTGACTGATGTAATCAGG + Intergenic
1118916121 14:70107887-70107909 CTGACCTGAATGATGAAAGGAGG - Intronic
1119068346 14:71553483-71553505 TTTGGCTGACTGAGGTAAGGAGG - Intronic
1123429302 15:20201365-20201387 CTGGCAGGACTGATGGTAGGTGG - Intergenic
1128756020 15:70184567-70184589 CTGCCCTGCCTGATGTAGGTGGG - Intergenic
1129125541 15:73437748-73437770 CTGGCTTGACTGATGCAAACAGG + Intergenic
1129536262 15:76315727-76315749 CTGGCCTGATGGATGTTATGTGG + Intergenic
1131684366 15:94754153-94754175 TGGGCTTGACTGATGTAATGGGG - Intergenic
1131684892 15:94757853-94757875 TGGGCTTGACTGATGTAATGGGG - Intergenic
1131882325 15:96874151-96874173 TGGGCTTGACTGATGTAATGGGG + Intergenic
1132340605 15:101075921-101075943 TGGGCTTGACTGATGTAATGGGG - Intronic
1132857359 16:2052632-2052654 CTGGCCTTACTCCTCTAAGGAGG - Intronic
1133832064 16:9332494-9332516 CTGGTCTGTCCGATGTAGGGGGG - Intergenic
1137736191 16:50725658-50725680 CTGGGCTAACTCATGTGAGGTGG + Intronic
1139473732 16:67192193-67192215 CTGGCCTGGCTGAGGGGAGGCGG + Exonic
1144313066 17:14031802-14031824 CTAATCTGACTGATGTGAGGTGG - Intergenic
1144407514 17:14966513-14966535 CTGGCCTGAAGGAAGAAAGGAGG - Intergenic
1149063865 17:52457298-52457320 CTACCCTGATTGATGTAAGATGG - Intergenic
1150975708 17:70084179-70084201 CTTGCATGACTTATGTAAGGTGG - Intronic
1151239424 17:72746197-72746219 CTGGCCTGAGGGATGTTATGAGG - Intronic
1152997749 18:424179-424201 CTGGCTGCACTGATGTAAGGCGG - Intronic
1157935586 18:51868697-51868719 CTATCCTGACTGATGTGAGATGG + Intergenic
1158699906 18:59736313-59736335 CTTGCCTGACTGAAGGAATGAGG - Intergenic
1161310098 19:3589309-3589331 CTTGCCGTACAGATGTAAGGAGG + Intronic
1161583887 19:5094817-5094839 CTGGCCTGACTGAGGAGTGGAGG - Intronic
1162187285 19:8915446-8915468 CTGGCATGGATGATGTAAGAGGG + Intronic
931856458 2:66307014-66307036 CTGTCCTGGCTCATGTAAGCAGG + Intergenic
933720010 2:85391685-85391707 CTGGCCTAATTGAGGGAAGGAGG + Exonic
934607526 2:95708422-95708444 CTGGCATTAGTGATGTGAGGAGG - Intergenic
935966332 2:108480211-108480233 CCATCCTGACTGATGTGAGGTGG - Intronic
936540920 2:113350613-113350635 CTGGCATTAGTGATGTGAGGAGG - Intergenic
936803134 2:116290705-116290727 CCGTTCTGACTGATGTGAGGTGG - Intergenic
936880057 2:117239729-117239751 CTATTCTGACTGGTGTAAGGTGG - Intergenic
939060504 2:137416193-137416215 CTGGCATGACAGATATCAGGTGG - Intronic
941827502 2:169916701-169916723 AAAGCCTGACTGAGGTAAGGAGG - Intronic
942446496 2:176081976-176081998 CCGGCCTGACGGATCTAAGAAGG - Intronic
943061754 2:183047270-183047292 TGGGCTTGACTGATGTAATGGGG - Intergenic
944547630 2:200812683-200812705 CAGGCCTGAGTGGTGCAAGGCGG + Intronic
946173330 2:217908224-217908246 CTGCCCTGAGTGAAGAAAGGAGG - Intronic
946959954 2:224974004-224974026 CTTCCCTGACTGATTTGAGGAGG + Intronic
1170704717 20:18734971-18734993 GTGGCCCGGCTGATGTCAGGGGG - Intronic
1170963019 20:21042089-21042111 CAGGCATCACTGATGTAGGGAGG - Intergenic
1173013071 20:39200090-39200112 CTGGCCTGACAGATGGAAAAGGG + Intergenic
1173416242 20:42858749-42858771 CTGGACTGACAGATGTCAAGGGG + Intronic
1175328421 20:58145894-58145916 CTGGCTTGAGAGATGTCAGGAGG + Intergenic
1175598436 20:60253797-60253819 CTGGCCTGATTGATGAAATGAGG - Intergenic
1177145828 21:17406166-17406188 CAGGCCTGACTGCTTTAAGTTGG + Intergenic
1182520728 22:30883235-30883257 CTTGCCTGCCTGATGCAAGTAGG - Intronic
1184024333 22:41843613-41843635 ATGCCCTGTCTGATGTAAGCAGG + Intronic
952346683 3:32494311-32494333 CTGGCCTGACTGGAGTGAGAAGG - Intronic
953460531 3:43078439-43078461 CAGGTCTGACTCCTGTAAGGGGG - Intergenic
953606135 3:44414554-44414576 GTGGCCTGGCTGCTGAAAGGAGG + Intergenic
953814905 3:46147193-46147215 CTGGCATGAGTGAGGGAAGGAGG + Intergenic
953952899 3:47206081-47206103 CTGGCCTGCCTGAAATAACGAGG + Intergenic
954299205 3:49690408-49690430 CTGGCCTCACTGATGTGTAGCGG - Intronic
954327647 3:49872330-49872352 CTGGCCAGAGTGATGGCAGGAGG + Intergenic
962146921 3:132849273-132849295 CTTCCCTGACTTCTGTAAGGTGG + Intergenic
963039039 3:141055377-141055399 CTGGCATGACTGGTCTGAGGTGG + Intronic
963120309 3:141770705-141770727 CTGTTCTGACTGGTGTGAGGTGG - Intergenic
963520626 3:146356934-146356956 TTGGCTTGACTGAAGTAATGGGG - Intergenic
963610569 3:147462392-147462414 CTACCATGAATGATGTAAGGGGG + Intronic
965077115 3:163993233-163993255 GAGGCCTGAATGAAGTAAGGAGG - Intergenic
967494835 3:190130982-190131004 CTGGACAGACTGAAGTAAGGAGG - Intergenic
972398522 4:38678220-38678242 CTGACCTCATTGATGTAAGCAGG + Intronic
975580451 4:75902500-75902522 CTGATCTGACTGACGTCAGGGGG - Exonic
978214911 4:106188048-106188070 CTTGCCTGACTGTTGTAACTAGG + Intronic
984317197 4:178142187-178142209 CTGGACTGACTGCTGTACTGGGG + Intergenic
987477127 5:18404276-18404298 CTGTTCTGACTGGTGTGAGGTGG + Intergenic
988789024 5:34590359-34590381 CTGGCCAGACTGATTTGTGGAGG - Intergenic
988865450 5:35329776-35329798 CCATCCTGACTGGTGTAAGGTGG - Intergenic
989261478 5:39424182-39424204 CTTGCCTGCCTGTTGTAAGCTGG - Intronic
990230832 5:53711893-53711915 GTGGCCTGACTGTTAAAAGGGGG - Intergenic
991046840 5:62231802-62231824 CTGGCAGGACTGATGGTAGGTGG - Intergenic
993692007 5:91013400-91013422 CTGTTCTGACTGGTGTAAGATGG + Intronic
998314445 5:141168903-141168925 CTTGACTGACTGCTGTGAGGAGG + Intergenic
1001117905 5:168955072-168955094 CTGGCCTTCCTGATGTTGGGGGG + Intronic
1006494870 6:34415242-34415264 CTGGCTTGAGTGATGTCAAGTGG - Intronic
1006987769 6:38188092-38188114 CTGGCCTGACTGAGCTAAGGCGG - Intronic
1009270002 6:61603482-61603504 CTGGCTTGACTGAAATAATGGGG - Intergenic
1009379325 6:63008704-63008726 CTGGCTTGACTGAAATAATGGGG - Intergenic
1009877465 6:69522758-69522780 CTATTCTGACTGATGTGAGGTGG - Intergenic
1012675276 6:102105333-102105355 TGGGCTTGACTGAAGTAAGGGGG - Intergenic
1013999647 6:116349724-116349746 CTGTCCTTACTGAAGTGAGGAGG + Intronic
1014236852 6:118967562-118967584 CTGTCCTGAATGATATGAGGTGG + Intronic
1016573935 6:145546405-145546427 CTGCCCTCACTGATGTGAGCAGG - Intronic
1017786456 6:157760866-157760888 CAGGCCTGGCTGATGCAAGCAGG + Intronic
1019600763 7:1882608-1882630 CAGGCCTGGCTGAGGAAAGGAGG - Intronic
1022030533 7:26488088-26488110 CTGGCCCAACTGAGGCAAGGGGG - Intergenic
1022138679 7:27473401-27473423 CCGCCCTGACTGGTGTGAGGTGG + Intergenic
1027932575 7:84556231-84556253 CTGGCCAAACTGATTTAAGAAGG + Intergenic
1028531926 7:91848034-91848056 TTGGCCTGGCTGGGGTAAGGAGG - Intronic
1031004857 7:116458885-116458907 TTGGCTTGACTGAAGTAATGGGG - Intronic
1034719764 7:153280373-153280395 CTGGGCTGAATGATTTAAGGAGG + Intergenic
1035231202 7:157467053-157467075 CTGCCCTGCCTGCTTTAAGGAGG + Intergenic
1042222792 8:66490121-66490143 TTGGCCTGAGAGAGGTAAGGCGG + Intronic
1045443567 8:102238782-102238804 CTGGCGTGACTGCGGTGAGGGGG + Intronic
1047226390 8:122958666-122958688 CTGGCCTGACAGTTGAGAGGTGG - Intronic
1048300128 8:133245272-133245294 GTGGCCTGACTGAGGTGGGGTGG - Intronic
1048585241 8:135769481-135769503 TGGGCCTGACTGAAGTAATGGGG + Intergenic
1049044474 8:140138581-140138603 CTGGCCTGACTGATCCCAGAAGG + Intronic
1053078349 9:35154011-35154033 ATGGCTTGACTGAAGTAATGGGG + Intergenic
1054984761 9:71248607-71248629 CTGTCTTAACTGATTTAAGGTGG + Intronic
1055296432 9:74838044-74838066 CTGGCCTGACTGTTGTTTAGTGG + Intronic
1058596388 9:106620572-106620594 CTTCCTTGACTGATGTAAAGTGG - Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1062105288 9:134751833-134751855 ATTGCCTGAATGATGGAAGGTGG + Intronic
1062262972 9:135672014-135672036 CTGGCCAGACTGATCTCAGATGG - Intergenic
1203780923 EBV:100431-100453 CTGGCCCGACTCATCTACGGAGG - Intergenic
1195326671 X:103764108-103764130 CGGGCTTGACTGAAGTAATGGGG + Intergenic
1201473359 Y:14356879-14356901 CTGGCTTGACTGAAGTAATGGGG + Intergenic
1201963621 Y:19708183-19708205 CTGGCCTGGCTGCTGTGAGATGG - Intronic