ID: 1078832529

View in Genome Browser
Species Human (GRCh38)
Location 11:14991391-14991413
Sequence GTGGACACACTTTGCGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 876
Summary {0: 1, 1: 3, 2: 21, 3: 147, 4: 704}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078832529_1078832538 12 Left 1078832529 11:14991391-14991413 CCCATATCGCAAAGTGTGTCCAC 0: 1
1: 3
2: 21
3: 147
4: 704
Right 1078832538 11:14991426-14991448 TGGTTCATAATATCCAGGGCAGG 0: 2
1: 7
2: 53
3: 354
4: 840
1078832529_1078832540 18 Left 1078832529 11:14991391-14991413 CCCATATCGCAAAGTGTGTCCAC 0: 1
1: 3
2: 21
3: 147
4: 704
Right 1078832540 11:14991432-14991454 ATAATATCCAGGGCAGGAGAGGG 0: 1
1: 2
2: 14
3: 91
4: 396
1078832529_1078832531 -8 Left 1078832529 11:14991391-14991413 CCCATATCGCAAAGTGTGTCCAC 0: 1
1: 3
2: 21
3: 147
4: 704
Right 1078832531 11:14991406-14991428 GTGTCCACCTCCCTGTGATATGG 0: 3
1: 4
2: 26
3: 81
4: 264
1078832529_1078832537 8 Left 1078832529 11:14991391-14991413 CCCATATCGCAAAGTGTGTCCAC 0: 1
1: 3
2: 21
3: 147
4: 704
Right 1078832537 11:14991422-14991444 GATATGGTTCATAATATCCAGGG 0: 21
1: 94
2: 582
3: 1193
4: 1663
1078832529_1078832539 17 Left 1078832529 11:14991391-14991413 CCCATATCGCAAAGTGTGTCCAC 0: 1
1: 3
2: 21
3: 147
4: 704
Right 1078832539 11:14991431-14991453 CATAATATCCAGGGCAGGAGAGG 0: 1
1: 12
2: 81
3: 258
4: 913
1078832529_1078832543 21 Left 1078832529 11:14991391-14991413 CCCATATCGCAAAGTGTGTCCAC 0: 1
1: 3
2: 21
3: 147
4: 704
Right 1078832543 11:14991435-14991457 ATATCCAGGGCAGGAGAGGGGGG 0: 1
1: 5
2: 16
3: 68
4: 539
1078832529_1078832541 19 Left 1078832529 11:14991391-14991413 CCCATATCGCAAAGTGTGTCCAC 0: 1
1: 3
2: 21
3: 147
4: 704
Right 1078832541 11:14991433-14991455 TAATATCCAGGGCAGGAGAGGGG 0: 1
1: 4
2: 15
3: 69
4: 295
1078832529_1078832536 7 Left 1078832529 11:14991391-14991413 CCCATATCGCAAAGTGTGTCCAC 0: 1
1: 3
2: 21
3: 147
4: 704
Right 1078832536 11:14991421-14991443 TGATATGGTTCATAATATCCAGG 0: 21
1: 112
2: 680
3: 1221
4: 1627
1078832529_1078832542 20 Left 1078832529 11:14991391-14991413 CCCATATCGCAAAGTGTGTCCAC 0: 1
1: 3
2: 21
3: 147
4: 704
Right 1078832542 11:14991434-14991456 AATATCCAGGGCAGGAGAGGGGG 0: 1
1: 5
2: 15
3: 118
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078832529 Original CRISPR GTGGACACACTTTGCGATAT GGG (reversed) Intronic
906457101 1:46006461-46006483 GTGGGCACACTATGCTATAAGGG + Intronic
917499062 1:175569355-175569377 GTGGACACAATTTGGGATGCTGG - Intronic
919000717 1:191827780-191827802 GTGTACACCCCTTGCAATATTGG + Intergenic
921280699 1:213564317-213564339 TTTGCCACACTTTGTGATATTGG + Intergenic
924860101 1:247911571-247911593 GTGTACACCCTCTGCGACATTGG - Intergenic
1064395054 10:14975246-14975268 GTGTACACAGCCTGCGATATTGG - Intronic
1064396845 10:14989378-14989400 GTGTACACACCCTGCGACATTGG - Intergenic
1064396875 10:14989528-14989550 GTGTACACCCCCTGCGATATTGG - Intergenic
1064397014 10:14990361-14990383 GTGTACACACACTTCGATATTGG - Intergenic
1064399759 10:15011844-15011866 GTGTACACACCCTGCGATATTGG - Intergenic
1064399791 10:15011997-15012019 GTGTACACCCCCTGCGATATTGG - Intergenic
1064399928 10:15012828-15012850 GTGCACACACACTTCGATATTGG - Intergenic
1072177063 10:92936930-92936952 GTGTACACCCTCTGCGATATTGG + Intronic
1074962231 10:118457402-118457424 GTGGCCACACTATGATATATAGG + Intergenic
1077604859 11:3602547-3602569 GTGTACACACCCTGCGACATTGG - Intergenic
1078288720 11:9984256-9984278 TTGGACACACTTTTAGAAATGGG + Intronic
1078832529 11:14991391-14991413 GTGGACACACTTTGCGATATGGG - Intronic
1078832560 11:14991546-14991568 GTGTACACACCCTTCGATATTGG - Intronic
1078832789 11:14992838-14992860 GTGGACACCCCTTGCGATATGGG - Intronic
1078832884 11:14993224-14993246 GTGGACACCCTTTGCAATATGGG - Intronic
1079038652 11:17042374-17042396 GTGTACACCCTCTGCGATATTGG + Intergenic
1079038833 11:17043401-17043423 GTGTACACACCCTGCGATATTGG + Intergenic
1081448323 11:43150559-43150581 GTGTACACCCCCTGCGATATTGG + Intergenic
1081448710 11:43153236-43153258 GTGTGCACCCTCTGCGATATTGG - Intergenic
1081449030 11:43155279-43155301 GTGTACACTCACTGCGATATTGG - Intergenic
1081449103 11:43155718-43155740 GTGTACACCCTTTGCGATATTGG - Intergenic
1081449335 11:43157120-43157142 GTGTACACTTTCTGCGATATTGG + Intergenic
1081449402 11:43157567-43157589 GTGTACACAGCTTGCAATATTGG + Intergenic
1081449557 11:43158598-43158620 GTGCACACCCCCTGCGATATTGG + Intergenic
1081449872 11:43160928-43160950 GTGTACACCCCCTGCGATATTGG - Intergenic
1081450861 11:43169686-43169708 GTGTACACCCATGGCGATATTGG + Intergenic
1081450930 11:43170191-43170213 GTGTACACCCTCTGCCATATAGG + Intergenic
1082168216 11:48970606-48970628 GTGTACATTCTCTGCGATATTGG + Intergenic
1082168302 11:48971208-48971230 GTGTACACCCATAGCGATATTGG + Intergenic
1082168327 11:48971363-48971385 GTGTACACCCTCTGTGATATTGG + Intergenic
1082168352 11:48971514-48971536 GTGGACACCCCCTGCGATATGGG + Intergenic
1082168414 11:48971886-48971908 GTGTACACTTTCTGCGATATTGG + Intergenic
1082235027 11:49814063-49814085 GTGTACACTTTCTGCGATATTGG - Intergenic
1082235090 11:49814435-49814457 GTGGACACCCCCTGCGATATGGG - Intergenic
1082235116 11:49814586-49814608 GTGTACACCCTCTGTGATATTGG - Intergenic
1082235142 11:49814741-49814763 GTGTACACCCATAGCGATATTGG - Intergenic
1082235231 11:49815343-49815365 GTGTACACTCTCTGCGATACTGG - Intergenic
1082608711 11:55274888-55274910 GTGTACACCTCTTGCGATATGGG - Intergenic
1082608765 11:55275262-55275284 GTGTACACCCTCTGCAATATAGG - Intergenic
1082608788 11:55275407-55275429 GTGGACACCCCCTGCGATATGGG - Intergenic
1082608831 11:55275712-55275734 GTGTACACCCATAGCGATATTGG - Intergenic
1082608919 11:55276314-55276336 GTGTACATTCTCTGCGATATTGG - Intergenic
1082936518 11:58662147-58662169 ATGTACACCCATTGCGATATTGG + Intronic
1082936803 11:58664082-58664104 GTGTACACACCCTGCGATATTGG + Intronic
1082937203 11:58667558-58667580 GTGTACACACTTTGTGAGGTAGG + Intronic
1084227353 11:67725509-67725531 GTGTACACCCCCTGCGATATTGG - Intergenic
1084227497 11:67726341-67726363 GTGTACACACACTTCGATATTGG - Intergenic
1084260752 11:67977131-67977153 GTGTACACACCCTGCGATATTGG - Intergenic
1084260784 11:67977280-67977302 GTGTACACCCCCTGCGATATTGG - Intergenic
1084260811 11:67977430-67977452 GTGTACACCCCCTGCGATATTGG - Intergenic
1084260917 11:67978038-67978060 GTGTACACACACTTCGATATTGG - Intergenic
1084261956 11:67984584-67984606 GTGTACACCCCCTGCGATATTGG + Intergenic
1084262040 11:67985037-67985059 GTGTACACTTTCTGCGATATTGG + Intergenic
1084262082 11:67985712-67985734 GTGTACACTCCCTGCGATATTGG - Intergenic
1084297348 11:68221629-68221651 ATAGACACACTTTGGGGTATTGG + Intergenic
1084807706 11:71590524-71590546 GTGTACACACACTTCGATATTGG + Intronic
1084807810 11:71591189-71591211 GTGTACACCCCCTGCGATATTGG + Intronic
1084807840 11:71591338-71591360 GTGTACACCCCCTGCGATATTGG + Intronic
1084807872 11:71591488-71591510 GTGTACACACCCTGCGACATTGG + Intronic
1084809073 11:71601406-71601428 GTGTACACTCCCTGCGATATTGG + Intronic
1084809118 11:71602084-71602106 GTGTACACTTTCTGCGATATTGG - Intronic
1084809204 11:71602537-71602559 GTGCACACCCTCTGCGATATTGG - Intronic
1084810719 11:71609380-71609402 GTGTACACCCCCTGCGATATTGG + Intergenic
1084810801 11:71609834-71609856 GTGTACACTTTCTGCGATATAGG + Intergenic
1084811728 11:71616080-71616102 GTGTACACACACTTCGATATTGG + Intergenic
1084811844 11:71616762-71616784 TTGTACACACCCTGCGATATTGG + Intergenic
1084811869 11:71616912-71616934 GTGTACACCCCCTGCGATATTGG + Intergenic
1084811903 11:71617062-71617084 GTGTACACACCCTGAGATATTGG + Intergenic
1086444436 11:86858776-86858798 GTGTACACCCTCTGCGATATTGG - Intronic
1086444886 11:86861412-86861434 GTGCACACCCCCTGCGATATGGG - Intronic
1086444895 11:86861486-86861508 GTGTACACCTTCTGCGATATAGG - Intronic
1086701602 11:89905722-89905744 GTGTACACCCTCTGTGATATTGG - Intergenic
1086701628 11:89905877-89905899 GTGTACACCCATAGCGATATTGG - Intergenic
1086701678 11:89906198-89906220 GTGTACACTCTCTGCGATATTGG + Intergenic
1086701767 11:89906800-89906822 GTGTACACCCATAGCGATATTGG + Intergenic
1086701792 11:89906955-89906977 GTGTACACCCTCTGTGATATTGG + Intergenic
1086701818 11:89907106-89907128 GTGGACACACCCTGCGATATGGG + Intergenic
1086704350 11:89937419-89937441 GTGGACACACCCTGCGATATGGG - Intergenic
1086704376 11:89937570-89937592 GTGTACACCCTCTGTGATATTGG - Intergenic
1086704401 11:89937725-89937747 GTGTACACCCATAGCGATATTGG - Intergenic
1086704490 11:89938327-89938349 GTGTACACTCTCTGCGATATTGG - Intergenic
1086704540 11:89938648-89938670 GTGTACACCCATAGCGATATTGG + Intergenic
1086704566 11:89938803-89938825 GTGTACACCCTCTGTGATATTGG + Intergenic
1087804076 11:102537136-102537158 GTGGACACACCTGTTGATATGGG + Intergenic
1092326734 12:7540188-7540210 GGGGAAAAACTTTGAGATATTGG + Intergenic
1092432058 12:8417906-8417928 GTGTACACCCCCTGCGATATTGG - Intergenic
1092432174 12:8418588-8418610 GTGTACACACACTTCGATATTGG - Intergenic
1092435028 12:8440847-8440869 GTGTACACACCCTGCGACATTGG - Intergenic
1092435772 12:8445567-8445589 GTGTACACTTTCTGCGATATTGG + Intergenic
1092436117 12:8447827-8447849 GTGTACACTTTCTGCGATATTGG + Intergenic
1092436162 12:8448513-8448535 GTGTACACTCCCTGCGATATTGG - Intergenic
1095697167 12:45155768-45155790 GTGTACACCCACTGCGATATTGG - Intergenic
1095697512 12:45157889-45157911 GTGTATACCCTCTGCGATATTGG - Intergenic
1096506704 12:52098291-52098313 GTGTACACACACTTCGATATTGG + Intergenic
1096506827 12:52098974-52098996 GTGTACACCCCCTGCGATATCGG + Intergenic
1096507011 12:52100045-52100067 GTGTACACACCCTGTGATATTGG + Intergenic
1096507054 12:52100271-52100293 GTGTCCACCCTCTGCGATATTGG + Intergenic
1096508816 12:52115544-52115566 GTGTACACACACTTCGATATTGG - Intergenic
1097432856 12:59530197-59530219 GTGTACACCCCTTGTGATATTGG - Intergenic
1097432870 12:59530278-59530300 GTGAACACCTTCTGCGATATTGG - Intergenic
1097432883 12:59530353-59530375 GCGGACACACACTGCGATTTGGG - Intergenic
1097433149 12:59531661-59531683 GTGTACACCCTCTGCGATATGGG - Intergenic
1097434015 12:59538821-59538843 GTGTACACCCCTTACGATATTGG - Intergenic
1097434174 12:59539875-59539897 GTGTACACCCCCTGCGATATTGG - Intergenic
1097434217 12:59540171-59540193 GTGTACACCCACTGCGATATTGG - Intergenic
1097434232 12:59540246-59540268 GTATACACACTCTGCAATATTGG - Intergenic
1097434391 12:59541236-59541258 GTGTACACCCTCGGCGATATTGG - Intergenic
1097434450 12:59541610-59541632 GTGTACACCTTCTGCGATATTGG - Intergenic
1097434495 12:59541847-59541869 GTGTACAGTCTCTGCGATATTGG - Intergenic
1097434514 12:59541998-59542020 GTGTACACCTTCTGCGATATTGG - Intergenic
1097434532 12:59542137-59542159 GTGTACACCTTCTGCGATATTGG - Intergenic
1097434761 12:59543505-59543527 GTGTACACCCATTGCGATATTGG - Intergenic
1097434789 12:59543660-59543682 GTGTACACCTCTTGCGATATTGG - Intergenic
1097435221 12:59546590-59546612 GTGGACACTTGCTGCGATATTGG - Intergenic
1097436052 12:59552600-59552622 GTGTATACCCCTTGCGATATTGG - Intergenic
1097436098 12:59552900-59552922 GTGTACACCCCCTGCGATATTGG - Intergenic
1098478990 12:70939428-70939450 GTGTACACCCCCTGCGATATTGG + Intergenic
1098479188 12:70940567-70940589 GTGTACACTCCTTTCGATATTGG + Intergenic
1098479483 12:70942505-70942527 GTGTACACCCTCTGCAATATTGG + Intergenic
1098479548 12:70942952-70942974 GTGTACACCCCCTGCGATATTGG + Intergenic
1098479615 12:70943330-70943352 GTGTACAACCTTAGCGATATTGG + Intergenic
1098479730 12:70944222-70944244 GTGTACACACCCTGCGATAGTGG + Intergenic
1099180307 12:79468343-79468365 CTGTACACTTTTTGCGATATTGG - Intergenic
1099180807 12:79471407-79471429 GTGTACACTTGTTGCGATATTGG - Intergenic
1099181008 12:79472749-79472771 ATGTACACACCCTGCGATATTGG - Intergenic
1099181162 12:79473785-79473807 GTGTACACCCCCTGCGATATAGG - Intergenic
1099181275 12:79474462-79474484 GTGTACACACCCTGCGATATTGG - Intergenic
1099181626 12:79476653-79476675 GTGTACACGCCTTGCGATATTGG - Intergenic
1099181684 12:79476955-79476977 GTGTACACACCCTGCGATATTGG - Intergenic
1107544993 13:41426612-41426634 GTGTACACTTTCTGCGATATTGG + Intergenic
1107548378 13:41454668-41454690 GTGTACACATCCTGCGATATTGG + Intergenic
1108817988 13:54314364-54314386 GTGGACACAGCCTGCGATACTGG + Intergenic
1109047771 13:57436314-57436336 TTGGACACACTTTTAGAAATGGG - Intergenic
1109353761 13:61216234-61216256 GTGAACACTCCCTGCGATATTGG - Intergenic
1109353811 13:61216463-61216485 GTGCACACCCCCTGCGATATAGG - Intergenic
1109354125 13:61218458-61218480 GTGTACACATTCTGTGATATTGG - Intergenic
1109354404 13:61220267-61220289 GTGTACACCCCATGCGATATTGG - Intergenic
1109354485 13:61220802-61220824 GTGTACACCCTCTGCTATATTGG - Intergenic
1109354760 13:61222633-61222655 GTGTACACCCGCTGCGATATTGG - Intergenic
1109354984 13:61224137-61224159 GTGTACACCCCCTGCGATATTGG - Intergenic
1109355101 13:61224839-61224861 GTGTACACCCCCTGCGATATTGG + Intergenic
1109355163 13:61225216-61225238 GTGTACACCTTCTGCGATATTGG + Intergenic
1109355320 13:61226331-61226353 GTGAACACTTTCTGCGATATTGG + Intergenic
1109355344 13:61226478-61226500 GTGTACACCCCCTGCGATATTGG + Intergenic
1109355772 13:61229119-61229141 GTGTACACCCCCTGCGATATTGG + Intergenic
1109355905 13:61229939-61229961 GTGTACACCCCTTTCGATATTGG + Intergenic
1109409197 13:61942207-61942229 GTGTACACTTTGTGCGATATTGG + Intergenic
1109409238 13:61942509-61942531 GTGTACACCCCCTGCGATATTGG + Intergenic
1109409279 13:61942738-61942760 TTGTACACTCTCTGCGATATTGG + Intergenic
1109409330 13:61943109-61943131 GTGTACACCCCTTGCAATATTGG + Intergenic
1109409423 13:61943701-61943723 GTGTACACCCTTTGCGATATTGG + Intergenic
1109409701 13:61946021-61946043 GTGTACATCCTCTGCGATATTGG - Intergenic
1109618838 13:64873463-64873485 GTGGAAACACTTCAGGATATTGG + Intergenic
1109840974 13:67915622-67915644 GTGTACACTCCCTGCGATATTGG + Intergenic
1109841016 13:67916292-67916314 GTGTACACTTTCTGCGATATTGG - Intergenic
1111810311 13:93090525-93090547 GTGGACACCCCCCGCGATATGGG + Intergenic
1111810327 13:93090662-93090684 GTGTACACCCTCTGCAATATAGG + Intergenic
1111810366 13:93090886-93090908 GTGTACACTCTCTGTGATATTGG + Intergenic
1111810703 13:93093151-93093173 GTGTACACCCCCTGCGATATTGG - Intergenic
1114435871 14:22707539-22707561 GTGTACACCCCATGCGATATGGG + Intergenic
1114435970 14:22708139-22708161 GTGTACACCCTTTGCGATATGGG + Intergenic
1114436043 14:22708667-22708689 GTGTACACCCTCTTCGATATTGG + Intergenic
1114436112 14:22709135-22709157 GTGTACACCCTCTGCAATATGGG + Intergenic
1114436126 14:22709210-22709232 GTGTACACATTTTCCGATATGGG + Intergenic
1114436143 14:22709298-22709320 GTGTACACCCTTTGTAATATGGG + Intergenic
1114436193 14:22709598-22709620 GTGTACACCTCTTGCGATATTGG + Intergenic
1114436275 14:22710181-22710203 GTGTACACCCCCTGCGATATTGG + Intergenic
1114436455 14:22711254-22711276 GTGTACACTTTCTGCGATATTGG - Intergenic
1114436498 14:22711481-22711503 GTGTACACCCCCTGCGATATTGG - Intergenic
1114436525 14:22711631-22711653 GTGTACACCCCTAGCGATATTGG - Intergenic
1114436874 14:22713966-22713988 GTGCACACCCCCTGCGATATTGG - Intergenic
1114436929 14:22714272-22714294 GTGCACACCCCCTGCGATATTGG - Intergenic
1115814127 14:37144485-37144507 GTGGACCCACTGTGGAATATTGG + Intronic
1116516659 14:45814014-45814036 GTGTACACACCTGGCGATATGGG - Intergenic
1116516928 14:45815606-45815628 GTGTACACTCCCTGCGATATTGG - Intergenic
1116517018 14:45816130-45816152 GTGTACACCCCCTGCGATATTGG - Intergenic
1116517304 14:45817794-45817816 GCGTACAGCCTTTGCGATATTGG - Intergenic
1116518270 14:45824082-45824104 TTGTACACCCTCTGCGATATTGG - Intergenic
1116518331 14:45824457-45824479 GTGTACACCCTTTGCGATATTGG - Intergenic
1116518342 14:45824531-45824553 GTGTACACCCTCTGTGATATTGG - Intergenic
1116518505 14:45825509-45825531 GTGTACACCCCCTGCGATATTGG - Intergenic
1116518934 14:45828253-45828275 GTGTACACCCTTTGCGATACTGG - Intergenic
1116518957 14:45828405-45828427 GTGTACACACCATGCGATATTGG - Intergenic
1116519054 14:45829066-45829088 GTGTACACCCCCTGCGATATTGG - Intergenic
1116519209 14:45830101-45830123 GTGTACACCCTCTGCAATATTGG - Intergenic
1116519238 14:45830331-45830353 GTGTACACCCCTTGCGATATTGG - Intergenic
1116519643 14:45832925-45832947 GTGTACACACCCTGGGATATTGG + Intergenic
1116519733 14:45833515-45833537 GTGTACATTTTTTGCGATATTGG + Intergenic
1116520019 14:45835508-45835530 GTGTACACCCTCTGCGATATTGG + Intergenic
1117037864 14:51745552-51745574 GTGTACACTCCCTGCGATATTGG + Intergenic
1117037992 14:51746682-51746704 GTGTACACCCCCTGCGATATTGG - Intergenic
1117039116 14:51753688-51753710 GTGTACACCCCCTGCGATATTGG + Intergenic
1117039181 14:51753990-51754012 GTGCACACACCCTGCGATATTGG + Intergenic
1117041445 14:51772553-51772575 GTGTACACCCCCTGCGATATTGG + Intergenic
1117041529 14:51773005-51773027 GTGTACACTTTCTGCGATATTGG + Intergenic
1202900575 14_GL000194v1_random:34186-34208 GAGAACACCCTCTGCGATATTGG + Intergenic
1125488162 15:40126736-40126758 GTGTACACCCTCTGCGATATTGG - Intergenic
1125488175 15:40126812-40126834 GTGCACACCCTCTGCCATATTGG - Intergenic
1125488244 15:40127264-40127286 GTGTACACAGACTGCGATATTGG - Intergenic
1125488472 15:40128703-40128725 GTTTACACGCTTTGCGATATTGG - Intergenic
1125488570 15:40129389-40129411 GTGTACACTCCCTGCGATATTGG + Intergenic
1125488603 15:40129547-40129569 GTGTACACTTTCTGCGATATTGG + Intergenic
1125488984 15:40132603-40132625 GTTTAAACGCTTTGCGATATTGG - Intergenic
1127666408 15:61151932-61151954 GTGGGCCCTCTTTGTGATATGGG - Intronic
1127878586 15:63134630-63134652 ATGGTCACACTTTGCGACAAGGG + Intronic
1129662215 15:77559388-77559410 GTGTACACCCCCTGCGATATTGG - Intergenic
1129662229 15:77559463-77559485 GTGTACACCCCCTGCGATATTGG - Intergenic
1129662712 15:77561881-77561903 GTGTACACTCCCTGCGATATAGG - Intergenic
1129662784 15:77562311-77562333 GTGTACACCCCCTGCGATATTGG - Intergenic
1130188499 15:81710016-81710038 GTGTACACTCCCTGCGATATTGG + Intergenic
1130188840 15:81712336-81712358 GTGTACACACCCTGCGATATTGG - Intergenic
1130188901 15:81712713-81712735 GTGTCCACCCCTTGCGATATTGG - Intergenic
1131003777 15:88959363-88959385 GTGGACAGATTTTGCCATGTTGG - Intergenic
1132243052 15:100275716-100275738 GTGGAAGCACTTTGCCATCTGGG + Intronic
1133991280 16:10709531-10709553 GTGTACACAGCCTGCGATATTGG + Intergenic
1133991718 16:10712336-10712358 GTGTACGCCCTCTGCGATATTGG + Intergenic
1133992109 16:10716663-10716685 GTGTACACCCTCTGCGGTATGGG + Intergenic
1136094200 16:27942827-27942849 GTACACACACTTTGCAAAATGGG + Intronic
1143292445 17:5842024-5842046 GTGGGCACACCCTGCGAGATGGG + Intronic
1143292556 17:5842767-5842789 TTGCACACTCTCTGCGATATTGG + Intronic
1155542633 18:26884207-26884229 GTGGACACCCCCTGCGATATGGG - Intergenic
1155542786 18:26885209-26885231 GTGTACACCCCTTGCAATATTGG + Intergenic
1155542899 18:26885889-26885911 GTGTACACAACCTGCGATATTGG + Intergenic
1155543032 18:26886717-26886739 GTGTACACCCCCTGCGATATTGG + Intergenic
1155543059 18:26886872-26886894 ATGTACACCCCTTGCGATATTGG + Intergenic
1155543329 18:26888771-26888793 GTGTACACTCCCTGCGATATTGG - Intergenic
1155543417 18:26889305-26889327 GTGTACACTTTCTGCGATATTGG - Intergenic
1156531174 18:37817099-37817121 GTGCACACATTTTGATATATTGG - Intergenic
1166236239 19:41459132-41459154 GTGGACACCTTTTTCGATATGGG + Intergenic
1166236260 19:41459280-41459302 GTGTACACGCTCTGCAATATTGG + Intergenic
1166236276 19:41459429-41459451 GTGTACACACTCTGTGAAATTGG + Intergenic
1166236299 19:41459579-41459601 GTGTACACCCTCTGCGATATAGG + Intergenic
1166236475 19:41460664-41460686 GTGTACACACTCTGCGATATCGG + Intergenic
1166237034 19:41464211-41464233 GTGTACACACCCCGCGATATAGG + Intergenic
1166237103 19:41464586-41464608 GTGTACACCTTCTGCGATATTGG + Intergenic
1166237284 19:41465778-41465800 GTGTACACCTTGTGCGATATTGG + Intergenic
1166237292 19:41465854-41465876 GTGTACACCCCCTGCGATATTGG + Intergenic
1166237492 19:41467123-41467145 GTGTACACACCCTGCGATACTGG + Intergenic
1166237565 19:41467590-41467612 GTGTACACCCACTGCGATATCGG + Intergenic
1166237731 19:41468729-41468751 GTGCACACACCCTGCGATATTGG + Intergenic
1166237892 19:41469721-41469743 TTGTACACCCTTTGCGATATTGG + Intergenic
1166237943 19:41470023-41470045 GTGTACACCCCCTGCGATATCGG + Intergenic
1166238146 19:41471318-41471340 GTGTACACACTTTGCGATATTGG + Intergenic
1166238270 19:41472261-41472283 TTGTACACACCCTGCGATATTGG + Intergenic
1166238291 19:41472411-41472433 GTGTACACCTTCTGCGATATTGG + Intergenic
1166238323 19:41472634-41472656 GTGTACACCCTTTGTGATATAGG + Intergenic
1166238599 19:41474200-41474222 GTGCACACTCTCTGCGATATTGG + Intergenic
1166238654 19:41474579-41474601 GTGTACACACCATTCGATATTGG + Intergenic
1166238734 19:41475068-41475090 GTGTACACCCTTTGAGATTTTGG + Intergenic
1166238876 19:41475975-41475997 GTGTACAGTCTTTGCGATATTGG + Intergenic
1166242205 19:41502093-41502115 GTGTACACACCCTGTGATATTGG + Intergenic
1166242230 19:41502243-41502265 GTGTACACCCTTTGCGATATTGG + Intergenic
1166242322 19:41502861-41502883 GTGTACACCCACTGCGATATGGG + Intergenic
1166242421 19:41503455-41503477 GTGTACACCCCCTGCGATATGGG + Intergenic
1166243761 19:41511324-41511346 GTGTACACCCTCTGCGATATTGG + Intergenic
1166243862 19:41511982-41512004 GTGTACAGTCTTTGCGATATTGG + Intergenic
1166243908 19:41512282-41512304 GTGTACACCCCATGCGATATTGG + Intergenic
1166244676 19:41517024-41517046 GTGTACACACCCCGCGATATGGG + Intergenic
1166244743 19:41517398-41517420 GTGTACACGTTCTGCGATATTGG + Intergenic
1166244826 19:41517928-41517950 GTGGACACACCCTGCGATATTGG + Intergenic
1166244844 19:41518077-41518099 GTGCACACCCCCTGCGATATTGG + Intergenic
1166244872 19:41518226-41518248 GTGTACACACCCTGAGATATTGG + Intergenic
1166244896 19:41518375-41518397 GTGTACACCCTCTCCGATATTGG + Intergenic
1166244943 19:41518680-41518702 GTGTACACCCTCTGCGATATTGG + Intergenic
1166245034 19:41519203-41519225 GTGTACACCTTTTGTGATATTGG + Intergenic
1166245084 19:41519504-41519526 GTGTACACCCCCTGCGATATTGG + Intergenic
1166245519 19:41522876-41522898 GTGTACACCCCCTGCGATATTGG + Intergenic
1166245532 19:41522950-41522972 GTGTACACACCCTGCGATATTGG + Intergenic
1166245657 19:41523748-41523770 GTGTACACCCCTTGCGATACTGG + Intergenic
1166245698 19:41524051-41524073 GTGTACACCCACTGCGATATTGG + Intergenic
1166245788 19:41524619-41524641 GTGTACACTCTCTTCGATATTGG + Intergenic
1166245848 19:41525076-41525098 GTGTACACATCCTGCGATATTGG + Intergenic
1202643854 1_KI270706v1_random:123452-123474 GAGTACACCCTCTGCGATATTGG - Intergenic
1202644751 1_KI270706v1_random:129935-129957 GTGTACACTCCTTACGATATTGG - Intergenic
1202644974 1_KI270706v1_random:131273-131295 GTGTACACCCACTGCGATATTGG - Intergenic
926656295 2:15410848-15410870 TTGGACAACCTTTGCTATATTGG - Intronic
928041910 2:27886991-27887013 GTGGACATACTTTGGGAGAGGGG - Intronic
932350272 2:71025604-71025626 GTGTACACCCCCTGCGATATTGG + Intergenic
932350330 2:71025903-71025925 GTGTACACACCCTGCGACATTGG + Intergenic
932352271 2:71042157-71042179 GTGTACACTCCCTGCGATATTGG + Intergenic
932353819 2:71052034-71052056 GTGTACACACCCTTCGATATTGG + Intergenic
932353883 2:71052485-71052507 GTTTACACACCCTGCGATATTGG + Intergenic
932353898 2:71052563-71052585 GTGTACACCCCTTGTGATATTGG + Intergenic
932353933 2:71052716-71052738 GTGTACACCTTCTGCGATATTGG + Intergenic
933456589 2:82526492-82526514 GTGTACACCCTCTGCGATATTGG + Intergenic
933456718 2:82527254-82527276 GTGTACACCCCCTGCGATATTGG + Intergenic
933456911 2:82529035-82529057 GTGTACACTTTCTGCGATATTGG - Intergenic
933457161 2:82530602-82530624 GTGTACAACCCTTGCGATATTGG - Intergenic
934506305 2:94897433-94897455 GTGTACACCCCCTGCGATATTGG - Intergenic
934507012 2:94902690-94902712 GTGTACACTCCCTGCGATATTGG + Intergenic
934507060 2:94903046-94903068 GTGTACACCCCCTGCGATATGGG - Intergenic
934507148 2:94903600-94903622 GTGTACACTCCTTACGATATTGG - Intergenic
934507209 2:94903959-94903981 GTGTGCACCCTTTGCGCTATTGG - Intergenic
934507339 2:94904707-94904729 GTGTACACATCCTGCGATATTGG - Intergenic
934507367 2:94904860-94904882 GTGTACACCCTCTGTGATATTGG - Intergenic
934591106 2:95550876-95550898 GTGTACACCCCCTGCGATATTGG + Intergenic
934591129 2:95551026-95551048 GTGTACACCCCCTGCGATATTGG + Intergenic
936557623 2:113509959-113509981 GTGTACACACCCTGTGATATGGG + Intergenic
936557658 2:113510185-113510207 GTGTACACCCCCTGCGATATTGG + Intergenic
940869908 2:158850903-158850925 GTGTACAAACCCTGCGATATTGG + Intronic
940872568 2:158871676-158871698 GTGTACACACCCTGCGACATTGG + Intergenic
940873433 2:158879024-158879046 GTGTACACAGCCTGCGATATTGG + Intergenic
940873757 2:158881242-158881264 GTGTACACCCCCTGCGATATTGG + Intergenic
940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG + Intergenic
940874732 2:158887509-158887531 GTGTACACCCCCTGCGATATTGG + Intergenic
940874764 2:158887659-158887681 GTGTACACACCCTGCGACATTGG + Intergenic
940874835 2:158888104-158888126 GTTTACACACTCTGCGATATTGG + Intergenic
941533267 2:166694396-166694418 GTGTACACTTTTGGCGATATTGG + Intergenic
941533331 2:166694775-166694797 GTGTACACAGTCTGCGATATTGG + Intergenic
941533466 2:166695999-166696021 GTGTACACACCCTGCGATGTTGG - Intergenic
941533550 2:166696505-166696527 GTGTACACCCTCTGCGATATTGG - Intergenic
941533566 2:166696581-166696603 GTGTACACCCCCTGCGATATTGG - Intergenic
942317062 2:174706403-174706425 GTGTACACTCCTTGAGATATTGG + Intergenic
942317198 2:174707237-174707259 GTGTACACCCCCTGCGATATTGG + Intergenic
942317211 2:174707310-174707332 GTGTACATACTTAGCGATACTGG + Intergenic
942317759 2:174710550-174710572 GTGTACACCCGCTGCGATATTGG + Intergenic
943476075 2:188357119-188357141 GGGGAAACACTTTAGGATATTGG + Intronic
943842219 2:192598211-192598233 GTGTACACTCCCTGCGATATTGG - Intergenic
943842257 2:192598466-192598488 GTGTACACCTTCTGCGATATTGG - Intergenic
943842441 2:192599554-192599576 GTGTACACTCCCTGCGATATTGG + Intergenic
943842489 2:192600226-192600248 GTGTACACTTTCTGCGATATCGG - Intergenic
943842695 2:192601422-192601444 GTGTACACCCCCTGCGATATTGG - Intergenic
944938846 2:204600248-204600270 GTGGAAACACTTTAAGACATTGG - Intronic
948713648 2:239842915-239842937 GGGGAAACACTTTGCAACATTGG - Intergenic
1171894705 20:30748853-30748875 GTGTACACTCCTTACGATATTGG - Intergenic
1171894890 20:30749966-30749988 GTGTACACATCCTGCGATATTGG - Intergenic
1171894936 20:30750194-30750216 GTGTACACCCACTGCGATATTGG - Intergenic
1176607128 21:8842720-8842742 GTGTACACTCCTTACGATATTGG + Intergenic
1176619950 21:9048964-9048986 GAGAACACCCTCTGCGATATTGG + Intergenic
1178443047 21:32613823-32613845 GTGTACACACCCTGCGATATTGG + Intergenic
1178443090 21:32614049-32614071 GTGTCCACCCTCTGCGATATTGG + Intergenic
1178443100 21:32614124-32614146 GTGTACACCCCCTGCGATATTGG + Intergenic
1179671650 21:42953673-42953695 GTTTACACACCCTGCGATATTGG - Intergenic
1179671722 21:42954127-42954149 GTGTACACACCCTGCGATATTGG - Intergenic
1179671754 21:42954276-42954298 GTGTACACCCCCTGCGATATTGG - Intergenic
1179671866 21:42954953-42954975 GTGTACACACACTTCGATATTGG - Intergenic
1180356985 22:11851171-11851193 GTGTACACCCACTGCGATATTGG + Intergenic
1180357209 22:11852508-11852530 GTGTACACTCCTTACGATATTGG + Intergenic
1180358114 22:11858981-11859003 GAGTACACCCTCTGCGATATTGG + Intergenic
1180380154 22:12133349-12133371 GAGTACACCCTCTGCGATATTGG - Intergenic
1180381277 22:12141160-12141182 GTGTACACCCACTGCGATATTGG - Intergenic
1183115728 22:35691302-35691324 GTGTACACTTCTTGCGATATTGG + Intergenic
1183115921 22:35692806-35692828 GTGTACACTCCCTGCGATATTGG - Intergenic
1183116036 22:35693487-35693509 GTGTACACCCCCTGCGATATGGG - Intergenic
1183116382 22:35695539-35695561 GTGTACACCCACTGCGATATTGG + Intergenic
1183116465 22:35695992-35696014 GTGTACACTTTCTGCGATATTGG + Intergenic
1183116506 22:35696661-35696683 GTGTACACTCCCTGCGATATTGG - Intergenic
1183116747 22:35698115-35698137 GTGTACACCCCCTGCGATATTGG + Intergenic
1183116832 22:35698568-35698590 GTGTACACTTTCTGCGATATTGG + Intergenic
1183116879 22:35699256-35699278 GTGTACACTCCCTGCGATATTGG - Intergenic
1183117319 22:35702017-35702039 GTGTACACCCCTTGCAATATTGG + Intergenic
949884887 3:8684944-8684966 GTGTACACCCCCTGCGATATTGG + Intronic
949884917 3:8685094-8685116 GTGTACACCCCCTGCGATATTGG + Intronic
954130729 3:48559400-48559422 GTGGACTCGCTTTGTGATCTTGG - Intronic
955388094 3:58495956-58495978 GTGGACAGACTTTTCGTTAACGG + Intronic
956713884 3:72061625-72061647 GTGGAGACAGTTTGAGATTTGGG + Intergenic
957044016 3:75360425-75360447 GTGTACACACCCTGCGACATTGG - Intergenic
957044073 3:75360725-75360747 GTGTACACTCCCTGCGATATTGG - Intergenic
957044188 3:75361409-75361431 GTGTACACACACTTCGATATTGG - Intergenic
957075751 3:75602214-75602236 GTGTACACTCCTTGTGATATTGG - Intergenic
957075809 3:75602606-75602628 GTGTACACACCCTGCGACATTGG - Intergenic
957077161 3:75611306-75611328 GTGTACACTCCCTGCGATATTGG - Intergenic
957077370 3:75612408-75612430 GTGTACACCCCCTGCGATATTGG + Intergenic
959982025 3:112527840-112527862 GTTTACATACCTTGCGATATTGG - Intergenic
961272564 3:125700039-125700061 GTGTACACCCCCTGCGATATTGG + Intergenic
961272592 3:125700189-125700211 GTGTACACCCCCTGCGATATTGG + Intergenic
961275314 3:125721594-125721616 GTGTACACACACTTCGATATTGG + Intergenic
961275482 3:125722576-125722598 GTGTACACACCCTGCGACATTGG + Intergenic
961278227 3:125744215-125744237 GTGTACACACACTTCGATATTGG + Intergenic
961278336 3:125744898-125744920 GTGTACACTCTCTGCGATATTGG + Intergenic
961278393 3:125745199-125745221 GTGTACACACCCTGCGACATTGG + Intergenic
961876003 3:130024459-130024481 GTGTACACACCCTGCGACATTGG - Intergenic
961876034 3:130024609-130024631 GTGTACACCCCCTGCGATATTGG - Intergenic
961876062 3:130024758-130024780 GTGTACACCCCCTGCGATATTGG - Intergenic
961876179 3:130025440-130025462 GTGTACACACACTTCGATATTGG - Intergenic
964888722 3:161514429-161514451 GTGTACACCCCTTGCGATATTGG + Intergenic
964888774 3:161514801-161514823 GTGTACACCCCCTGCGATATTGG + Intergenic
964888807 3:161514954-161514976 GAGTACACCCCTTGCGATATTGG + Intergenic
964888884 3:161515404-161515426 GTGTACACACCCTGCGATATTGG + Intergenic
964888940 3:161515780-161515802 GTGTACACCCGCTGCGATATTGG + Intergenic
964889008 3:161516202-161516224 GTGTACACCCTGTGCGATATTGG + Intergenic
964889341 3:161518098-161518120 GTGTACACACCTCACGATATGGG + Intergenic
964889499 3:161518924-161518946 GTGTACACCCCATGCGATATTGG + Intergenic
964889566 3:161519301-161519323 GTGTACACCCCATGCGATATTGG + Intergenic
964889762 3:161520509-161520531 GTGTACACCCTTAGGGATATTGG + Intergenic
965399285 3:168198492-168198514 GTGTACACCCCTTGTGATATTGG + Intergenic
965399385 3:168199076-168199098 GTGTACACTCCTTGCGATATTGG + Intergenic
965399599 3:168200462-168200484 GTGTACACAACCTGCGATATGGG + Intergenic
965399875 3:168202118-168202140 GTGTACACCCTCTGCGATATGGG + Intergenic
968988366 4:3892204-3892226 GTGTACACACCTTGTGACATTGG - Intergenic
968988424 4:3892503-3892525 GTGTACACCCCCTGCGATATTGG - Intergenic
968988545 4:3893260-3893282 GTGTACACACCCTGCGACATGGG - Intergenic
969019539 4:4130559-4130581 GTGTACACACCCTGCGACATTGG - Intergenic
969020554 4:4137436-4137458 GTGTACACTCCCTGCGATATTGG - Intergenic
969022680 4:4148338-4148360 GTGTACACCCCCTGCGATATTGG + Intergenic
969023993 4:4159382-4159404 GTGTACACACCCTGCGACATTGG - Intergenic
969024037 4:4159607-4159629 GTGTACACCCCCTGCGATATTGG - Intergenic
969024142 4:4160285-4160307 GTGTACACACACTTCGATATTGG - Intergenic
969025133 4:4166849-4166871 GTGTACACACCCTGCGACATGGG - Intergenic
969729678 4:8946854-8946876 GTGTACACACACTTCGATATTGG + Intergenic
969729795 4:8947537-8947559 GTGTACACCCCCTGCGATATTGG + Intergenic
969729830 4:8947687-8947709 GTGTACACACCCTGCGACATTGG + Intergenic
969731018 4:8957691-8957713 GTGTACACTCCCTGCGATATTGG + Intergenic
969733278 4:8969900-8969922 GTGTACACTCCCTGCGATATTGG + Intergenic
969733404 4:8971034-8971056 GTGTACACCCCCTGCGATATTGG - Intergenic
969734420 4:8977532-8977554 GTGAACACACACTTCGATATTGG + Intergenic
969734530 4:8978138-8978160 GTGTACACCCTCTGCGATATTGG + Intergenic
969734570 4:8978364-8978386 GTGTACACCCCTTGCGATATTGG + Intergenic
969734599 4:8978515-8978537 GTGTACGCACCCTGCGATATTGG + Intergenic
969785842 4:9456405-9456427 GTGTACACACACTTCGATATTGG + Intergenic
969785995 4:9457314-9457336 GTGTACACACCCTGCGACATTGG + Intergenic
969789252 4:9480737-9480759 GTGTACACACTCTGGGATGTTGG + Intergenic
969789409 4:9481646-9481668 GTGTACACACCCTGCGATATTGG + Intergenic
969789440 4:9481796-9481818 GTGTACACACCCTGCGACATTGG + Intergenic
969790637 4:9491878-9491900 GTGTACACTCCCTGCGATATTGG + Intergenic
969790684 4:9492560-9492582 GTGTACACTTTCTGCGATATTGG - Intergenic
969792868 4:9503976-9503998 GTGTACACTCCCTGCGATATTGG + Intergenic
969793001 4:9505098-9505120 GTGTACACCCCCTGCGATATTGG - Intergenic
969793909 4:9510969-9510991 GTGTACACACCCTGCGACATTGG + Intergenic
971025739 4:22586815-22586837 GTGTACACACCCTGTGATATTGG + Intergenic
971025938 4:22588004-22588026 GTGTACACCTTCTGCGATATTGG + Intergenic
971025981 4:22588738-22588760 GTGTACACTCCCTGCGATATCGG - Intergenic
972487062 4:39552112-39552134 GTGGACTAACTTTGTGATATGGG - Exonic
973370991 4:49248494-49248516 GTGTACACTCCTTACGATATTGG - Intergenic
973390035 4:49546961-49546983 GTGTACACTCCTTACGATATTGG + Intergenic
978067574 4:104424503-104424525 GTGGACACACTTTGACAGAAGGG - Intergenic
978482151 4:109205427-109205449 GTGGACAGACATTGACATATAGG + Intronic
978984347 4:114991505-114991527 GTGGACACAGCATGTGATATAGG + Intronic
979753753 4:124313214-124313236 TTGTACACACTTTGCTATAATGG - Intergenic
983623227 4:169781922-169781944 GTGTACACCCCCTGCGATATTGG - Intergenic
983623261 4:169782146-169782168 GTGTACACCCCCTGCGATATTGG - Intergenic
983623333 4:169782601-169782623 GTGTACACACAATGCGATATGGG - Intergenic
983623370 4:169782823-169782845 GTGTACACATTCTGCGATATGGG - Intergenic
983623387 4:169782898-169782920 GTGAACACGCCTTGCAATATGGG - Intergenic
983623535 4:169783707-169783729 GTGTACACCCACTGCGATATGGG - Intergenic
983623697 4:169784610-169784632 GTGTACAGGCCTTGCGATATTGG - Intergenic
983623795 4:169785256-169785278 GTGTACACCCTCTGCGATATTGG - Intergenic
983623804 4:169785330-169785352 GTGCACACCCTCTGTGATATTGG - Intergenic
983623926 4:169786099-169786121 GTGTACACACCCTGCGATATTGG + Intergenic
983623979 4:169786407-169786429 GTGTACACACCCTGAGATATTGG + Intergenic
983624030 4:169786703-169786725 GTGTACACTCCCTGCGATATGGG + Intergenic
983624220 4:169787746-169787768 GTGTACACCGTTTGTGATATTGG + Intergenic
983624233 4:169787822-169787844 GTGTACACCCACTGCGATATTGG + Intergenic
983624246 4:169787899-169787921 GTGTACACCTTCTGCGATATTGG + Intergenic
983624352 4:169788541-169788563 CTGTACACCCTTTGCGATATTGG + Intergenic
983624389 4:169788765-169788787 GTGTACACCCCTAGCGATATTGG + Intergenic
1202771226 4_GL000008v2_random:209384-209406 GAGTACACCCTCTGCGATATTGG - Intergenic
988370123 5:30357999-30358021 GTGGACACACTCTGGTATAAGGG - Intergenic
994391326 5:99196391-99196413 GTGTACACACCCTGCGATATTGG + Intergenic
994391347 5:99196538-99196560 GTGTACACCTTTTGTGATATTGG + Intergenic
994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG + Intergenic
994391489 5:99197502-99197524 GTGGAAAACCTTTTCGATATTGG + Intergenic
994391626 5:99198257-99198279 GTGGACACCCCCTGCGATACTGG + Intergenic
994391674 5:99198557-99198579 GTGGACACCCCTTGCGACATTGG + Intergenic
994391687 5:99198632-99198654 GTGTACACGCTCTGCGATATTGG + Intergenic
994391696 5:99198707-99198729 ATGTACACTCCTTGCGATATTGG + Intergenic
994391732 5:99199001-99199023 GTGTACACCCGCTGCGATATTGG + Intergenic
994391908 5:99200189-99200211 GTGTACACCTTCTGCGATATTGG + Intergenic
994392010 5:99200784-99200806 GTGCACACACCCTGCGCTATTGG + Intergenic
994392090 5:99201306-99201328 GTGTACACCCCCTGCGATATTGG + Intergenic
994392120 5:99201485-99201507 GTGTACACCTTCTGCGATATTGG + Intergenic
994392288 5:99202575-99202597 GTGTACCCCCTCTGCGATATTGG + Intergenic
994392713 5:99205462-99205484 GTGTACACCCCCTGCGATATTGG + Intergenic
994392732 5:99205612-99205634 GTGTACACACCCTGAGATATTGG + Intergenic
994392848 5:99206260-99206282 GTGTACATTCTTTGAGATATTGG + Intergenic
994393003 5:99207255-99207277 GTGTACACACCCTTCGATATAGG + Intergenic
994393010 5:99207328-99207350 GTGTACACCCTCTGTGATATTGG + Intergenic
994393340 5:99209363-99209385 GTGGACACCCACTGTGATATTGG + Intergenic
994393504 5:99210433-99210455 ATGTACACCCTCTGCGATATTGG + Intergenic
994393558 5:99210809-99210831 GTGTACACCCCCTGCGATATAGG + Intergenic
994393595 5:99211034-99211056 GTGTACACCTTCTGCGATATTGG + Intergenic
994393712 5:99211718-99211740 GTGTACACACCTTTCGATATAGG + Intergenic
994394127 5:99214551-99214573 ATGTACACCCCTTGCGATATTGG + Intergenic
994394174 5:99214849-99214871 GTGTACACCTTCTGCGATATTGG + Intergenic
994394186 5:99214921-99214943 GTGTACACCCCTTTCGATATTGG + Intergenic
994394198 5:99214996-99215018 GTGTACACACTCTACGATACGGG + Intergenic
994394423 5:99216507-99216529 GTGTACACCCTCTGCGGTATTGG + Intergenic
994394757 5:99218585-99218607 GTGTACACACCCTACGATATTGG + Intergenic
994394797 5:99218889-99218911 GTGTACACCCCTTGCAATATTGG + Intergenic
994394921 5:99219668-99219690 GTGTACACCCTGTGCAATATTGG + Intergenic
994395108 5:99220728-99220750 GTGGACACTTCCTGCGATATTGG + Intergenic
994395247 5:99221637-99221659 GTGTACACTTTTTGCGATATGGG + Intergenic
994395348 5:99222167-99222189 GTGTACACCCTCTGCGATTTTGG + Intergenic
994395364 5:99222242-99222264 GTGTACACCCTTTGTGACATTGG + Intergenic
994395533 5:99223332-99223354 GTGCACACCCCGTGCGATATTGG + Intergenic
994395724 5:99224606-99224628 ATGTACACCCTCTGCGATATTGG + Intergenic
994395925 5:99225738-99225760 GTGTACATACTTAGCGATATTGG + Intergenic
994395944 5:99225886-99225908 GTGTACACACTCTGAGATATTGG + Intergenic
994396140 5:99227101-99227123 GTGTACACCCATTGCAATATTGG + Intergenic
994396293 5:99228148-99228170 GTGTACACACTTTGCGATATTGG + Intergenic
994396359 5:99228617-99228639 GTGTACACACCCTGCGATATTGG + Intergenic
994396374 5:99228697-99228719 GTGTGCACACTCTGCGATATAGG + Intergenic
994397041 5:99233720-99233742 GTGTACACTTTTTGTGATATTGG - Intergenic
996607352 5:125339314-125339336 GAGGAAACACTTTGTGATATGGG - Intergenic
997682104 5:135764089-135764111 GTGTACACCCCTTGCGATATGGG - Intergenic
997682158 5:135764376-135764398 CTGTACACCCTTTGCAATATGGG - Intergenic
997682212 5:135764657-135764679 GTGTACACCCTCTGCGATATGGG - Intergenic
997682324 5:135765239-135765261 GTGTACACACCCTGCGATGTGGG - Intergenic
997682752 5:135767604-135767626 GTGTACACCCCCTGCGATATTGG - Intergenic
997682783 5:135767833-135767855 GTGTACAAACTCTGCGATATTGG - Intergenic
997682824 5:135768059-135768081 GTGTACACCCGCTGCGATATTGG - Intergenic
997682836 5:135768150-135768172 GTGTACACCCACTGCGATATTGG + Intergenic
997682964 5:135769136-135769158 GTGTACACCCCTTGCGATATTGG - Intergenic
997683125 5:135770186-135770208 GTGTACACCCCCTGCGATATTGG - Intergenic
997683223 5:135770785-135770807 GTATACACCCTTTGCGATATTGG - Intergenic
997683507 5:135772653-135772675 GTGTACACCCTTGGCGATTTGGG - Intergenic
997683546 5:135773016-135773038 GTGTACACCCCCTGCGATATTGG - Intergenic
997683576 5:135773242-135773264 GTGTACACATTCTGAGATATTGG - Intergenic
997683634 5:135773631-135773653 GTGTACACATTCTGGGATATTGG - Intergenic
997683710 5:135774111-135774133 GTGTACACACCCTTCGATATAGG - Intergenic
997683759 5:135774414-135774436 TTGTACACCCTCTGCGATATTGG - Intergenic
997684097 5:135776678-135776700 GTGTACACCCTCTGTGATATTGG - Intergenic
997684299 5:135777967-135777989 GTGTACACCATTTGCGATATTGG - Intergenic
997684336 5:135778194-135778216 GTGTACACGCCCTGCGATATTGG - Intergenic
997684388 5:135778514-135778536 GTGTACACCCTCTGCGACATTGG - Intergenic
997685093 5:135782928-135782950 GTGCACACCCCCTGCGATATTGG - Intergenic
997685135 5:135783153-135783175 GTGTACGCCCTGTGCGATATTGG - Intergenic
997685238 5:135783909-135783931 GTGTACACTCCTTGCAATATTGG - Intergenic
997685282 5:135784247-135784269 GTGTACACTCTCTGCGCTATTGG - Intergenic
997686900 5:135795161-135795183 GTGTACACCCCTTGCGATATTGG - Intergenic
997686912 5:135795237-135795259 GTGTACACCTTCTGCGATATTGG - Intergenic
997687266 5:135797184-135797206 GTGTACACCCACTGCGATATTGG - Intergenic
997687348 5:135797850-135797872 GTGTACACCTTTTGCGATATTGG - Intergenic
997687516 5:135798983-135799005 GTGTACACCCTCTGCGATAATGG - Intergenic
997687523 5:135799059-135799081 GTGTACATTCTTTGCGATATTGG - Intergenic
997687627 5:135799671-135799693 ATGTCCACCCTTTGCGATATTGG - Intergenic
997687830 5:135800991-135801013 GTGTACACACCCTGCGATATTGG - Intergenic
997687867 5:135801216-135801238 GTGTACACCCCTTGTGATATTGG - Intergenic
997687919 5:135801580-135801602 GTGTACACCTTCTGCGATATTGG - Intergenic
997687941 5:135801727-135801749 GTGCACACACCCTGTGATATTGG - Intergenic
998935362 5:147227666-147227688 GTGTACACTTTCTGCGATATTGG + Intergenic
998935437 5:147228189-147228211 TTGTACACTCTCTGCGATATTGG + Intergenic
998935539 5:147228849-147228871 GTGTACACCCTCTGCAATATAGG + Intergenic
998935579 5:147229074-147229096 GTGTACTCTCTCTGCGATATTGG + Intergenic
998935905 5:147231459-147231481 GTGTACACCCCCTGCGATATTGG - Intergenic
1004561398 6:16755049-16755071 GTGCACACACATTGTCATATAGG - Intronic
1008221336 6:48857165-48857187 GTGGACAAAGTTTGCAATAGAGG + Intergenic
1009046328 6:58240995-58241017 GTGTACACCTTCTGCGATATTGG - Intergenic
1009046844 6:58244368-58244390 GTGGACACCCTCTGCGATATTGG - Intergenic
1009047168 6:58246413-58246435 GTGTACACACTTTGCGATATTGG - Intergenic
1009048021 6:58251010-58251032 GTGTACACACCCTGCGATATAGG - Intergenic
1009048027 6:58251080-58251102 GTGCACACCATTTTCGATATTGG - Intergenic
1009048124 6:58251829-58251851 GTGTACACCCCCTGCGATATTGG - Intergenic
1009048460 6:58254019-58254041 ATGTACACCCCTTGCGATATTGG - Intergenic
1009048612 6:58254980-58255002 GTGTACACCTTTTGCAATATTGG + Intergenic
1009048868 6:58256801-58256823 GTGTACACCCCCTGCGATATGGG + Intergenic
1009049342 6:58259507-58259529 GTGTACACCTTTTGTGATATTGG + Intergenic
1009049669 6:58261751-58261773 GTGTACACCCCCTGCGATATCGG + Intergenic
1009049747 6:58262276-58262298 GTGTACACCCCTTGTGATATTGG + Intergenic
1009049862 6:58263101-58263123 GTGTACACCCTCTGCGATAGTGG + Intergenic
1009050092 6:58264689-58264711 GTATACACCCCTTGCGATATTGG + Intergenic
1009222143 6:60995312-60995334 GTGTACACCTTCTGCGATATTGG - Intergenic
1009222656 6:60998672-60998694 GTGGACACCCTCTGCGATATTGG - Intergenic
1009222700 6:60998900-60998922 ATGTACACCCTTTGCGATATTGG - Intergenic
1009222808 6:60999676-60999698 GTGGGCACACCCTACGATATTGG - Intergenic
1009222977 6:61000710-61000732 GTGTACACGCTTTGCGATATTGG - Intergenic
1009223361 6:61002880-61002902 GTGTACACTCCTTGCAATATGGG - Intergenic
1009223912 6:61005859-61005881 GTGCACACCATTTTCGATATTGG - Intergenic
1009224008 6:61006610-61006632 GTGTACACCCCCTGCGATATTGG - Intergenic
1009224333 6:61008794-61008816 ATGTACACCCCTTGCGATATTGG - Intergenic
1009224472 6:61009741-61009763 GTGTACACCTTTTGCAATATTGG + Intergenic
1009224673 6:61011172-61011194 GTGTACACGCCCTGCGATATTGG + Intergenic
1009224897 6:61012741-61012763 GTGTACACCTTTTGTGATATTGG + Intergenic
1009225217 6:61014989-61015011 GTGTACACCCCCTGCGATATTGG + Intergenic
1009225255 6:61015289-61015311 TTCTACACCCTTTGCGATATCGG + Intergenic
1009225410 6:61016360-61016382 GTGTACACGCTCTGCGATAGTGG + Intergenic
1009225415 6:61016437-61016459 GTGTACACACCCTACGATATTGG + Intergenic
1009225631 6:61017946-61017968 GGGTACACCCCTTGCGATATTGG + Intergenic
1009225666 6:61018246-61018268 GTGTACACACCCTGCGATAATGG + Intergenic
1009225807 6:61019289-61019311 GTGTACACCCTCTGCGATATTGG + Intergenic
1009225934 6:61020120-61020142 GTGTACACCCCCTGCGATATTGG + Intergenic
1009226074 6:61021103-61021125 GTGTACACACCTTGTGATATTGG + Intergenic
1009226387 6:61023958-61023980 GTGTACACTCTCTGCAATATTGG - Intergenic
1009226422 6:61024182-61024204 GAGTACACCCTTTGCGACATTGG - Intergenic
1009226955 6:61029009-61029031 GTGTACACCCCCTGCGATATTGG + Intergenic
1009227757 6:61033836-61033858 TTGTACGCACTTTGGGATATGGG + Intergenic
1009228050 6:61035496-61035518 GTGTACACCCCTTGCGACATTGG + Intergenic
1009228086 6:61035681-61035703 GTGTTCACACCCTGCGATATTGG + Intergenic
1009228362 6:61037416-61037438 GTGCACACACCCTGAGATATTGG + Intergenic
1009228450 6:61037950-61037972 GTGTACACCCCCTGCGATATTGG + Intergenic
1009228709 6:61039688-61039710 ATGTACATCCTTTGCGATATTGG + Intergenic
1009228898 6:61040917-61040939 GTGTACACCCTTTGCAATATTGG + Intergenic
1009228924 6:61041142-61041164 GTGTACACCCCTTGCGATATTGG + Intergenic
1009228939 6:61041292-61041314 GTGTACATCCTCTGCGATATTGG + Intergenic
1009228960 6:61041441-61041463 GTGTACACCCCTTGCGGTATTGG + Intergenic
1009362738 6:62835392-62835414 GTGTACACACCTTGCCATACTGG - Intergenic
1009362833 6:62836028-62836050 GTGTACACCCCCTGCGATATTGG - Intergenic
1009362991 6:62837238-62837260 GTGTACACACCCTGCGATATTGG - Intergenic
1009363057 6:62837687-62837709 GTGTACACTCTCTGCAATATTGG - Intergenic
1009363330 6:62839497-62839519 GTGGACACTCCCTGCGATATTGG - Intergenic
1009363379 6:62839875-62839897 GTGTACACCCCTTGAGATATTGG - Intergenic
1009363600 6:62841148-62841170 GTGTACACTCTCTGCAATATTGG - Intergenic
1009363656 6:62841523-62841545 GTGTACACCCCCTGCGATATTGG - Intergenic
1009363799 6:62842663-62842685 GTATACACACCCTGCGATATTGG - Intergenic
1009363840 6:62842966-62842988 GTGTACAAACTCTGTGATATTGG - Intergenic
1009363880 6:62843266-62843288 GTGGACACCCCCTGCGATATTGG - Intergenic
1009363932 6:62843699-62843721 GTGTACACCCCCTGCGATATGGG - Intergenic
1009364069 6:62844684-62844706 GTGGACACCTTCCGCGATATGGG - Intergenic
1009364110 6:62844840-62844862 GTGGACACCCCCCGCGATATTGG - Intergenic
1009364129 6:62844915-62844937 GTGGACACACCCAGTGATATGGG - Intergenic
1009364374 6:62846626-62846648 GTGTACACCCACTGCGATATTGG + Intergenic
1009364451 6:62847221-62847243 GTGTACACACCCTGCGATATTGG + Intergenic
1009364489 6:62847526-62847548 TTGTACACCCTTTGCGATATTGG + Intergenic
1009364604 6:62848347-62848369 GTGTACACCCCCTGCGATATTGG + Intergenic
1009365435 6:62854221-62854243 GTATACACTCTGTGCGATATTGG - Intergenic
1009365505 6:62854752-62854774 GTGTGCACTCCTTGCGATATTGG - Intergenic
1009365604 6:62855660-62855682 GGGTGCACACTCTGCGATATTGG - Intergenic
1009365702 6:62856244-62856266 GTGCACACCCCTTGCTATATTGG - Intergenic
1009365782 6:62856743-62856765 TTGTACACCCTTTGCGATATTGG - Intergenic
1009366021 6:62858491-62858513 GTGTACACACCCTGCGAAATTGG - Intergenic
1009366090 6:62859092-62859114 GTGGACACCCTTTGCGATAATGG - Intergenic
1009366124 6:62859395-62859417 GTGTACATCCCTTGCGATATTGG - Intergenic
1009366135 6:62859470-62859492 GTGTACACTCTTTGAGATATTGG - Intergenic
1009366155 6:62859548-62859570 GTGTACACCCCCTGCGATATGGG - Intergenic
1009366706 6:62862233-62862255 GTGTATGCTCTTTGCGATATGGG + Intergenic
1009367251 6:62865080-62865102 GTGTACACATCCTGCGATATTGG + Intergenic
1009367304 6:62865456-62865478 GTGCACACTCCCTGCGATATTGG + Intergenic
1009367420 6:62866365-62866387 GTGTACACCCTTTGGAATATTGG + Intergenic
1009367530 6:62867323-62867345 GTGTACACTCTTTGCGATATTGG + Intergenic
1009367614 6:62868071-62868093 GTGTACACGCTCTGCGATATTGG + Intergenic
1009368088 6:62871299-62871321 GTGTACACCCCCTGCGATATTGG - Intergenic
1009368236 6:62872504-62872526 GTGTACACCCTTTGCAATATTGG - Intergenic
1009368283 6:62872891-62872913 GTGTACACGTTCTGCGATATTGG - Intergenic
1009368569 6:62875070-62875092 GTGTACACTCCTTGAGATATTGG - Intergenic
1009368581 6:62875146-62875168 GTGTACACCCCCTGCGATATTGG - Intergenic
1009368636 6:62875607-62875629 GTGTACGCACCCTGCGATATTGG - Intergenic
1009369049 6:62878778-62878800 GTGTACACCCTTTGCCATATTGG - Intergenic
1009369159 6:62879582-62879604 GTGTACACACTCTGCGATATTGG - Intergenic
1009369433 6:62881469-62881491 GTGTACACCTTCTGCGATATTGG - Intergenic
1009369731 6:62883522-62883544 GTGTACACGCTGTGCGATATTGG - Intergenic
1009460487 6:63907027-63907049 GTGTACACACTATGCAATCTTGG - Intronic
1012773859 6:103479081-103479103 GTGTACACGCCTTGCAATATTGG - Intergenic
1012774078 6:103480514-103480536 GTGTACACCCCATGCGATATTGG - Intergenic
1012774139 6:103480908-103480930 GTGTACACTCCCTGCGATATTGG + Intergenic
1012774245 6:103481590-103481612 GTGTACACACTATGCGATATTGG + Intergenic
1012774327 6:103482125-103482147 GTGTACACCTTGTGCGATATTGG + Intergenic
1012774446 6:103482900-103482922 GTGTACACCCCCTGCGATATTGG + Intergenic
1012774473 6:103483050-103483072 GTGAACACCCCCTGCGATATTGG + Intergenic
1012774704 6:103484582-103484604 GTGTACACTCCATGCGATATGGG + Intergenic
1012774716 6:103484657-103484679 GTGTACACCCTTTGCGATATGGG + Intergenic
1012774804 6:103485245-103485267 GTGTACACCCCTTGCGATATTGG + Intergenic
1012774913 6:103486065-103486087 GTGTACACTCCTTGCGGTATTGG + Intergenic
1012774923 6:103486136-103486158 GTGTACACTCTTTGCAATATTGG + Intergenic
1012774992 6:103486622-103486644 GTGTACACACCCTGCGATATTGG - Intergenic
1012775234 6:103488204-103488226 GTGTACACCCCTTGCGATACTGG - Intergenic
1012775392 6:103489180-103489202 GTGTACACCCCTTGCTATATTGG - Intergenic
1020306639 7:6840924-6840946 GTGTACACACCCTGCGATATTGG - Intergenic
1020306674 7:6841071-6841093 GTGTACACCCCCTGCGATATTGG - Intergenic
1020306703 7:6841221-6841243 GTGTACACCCCCTGCGATATTGG - Intergenic
1020307864 7:6848415-6848437 GTGTACACTCCCTGCGATATTGG + Intergenic
1020307945 7:6848865-6848887 GTGTACACTTTCTGCGATATAGG + Intergenic
1020307989 7:6849546-6849568 GTGTACACTCCCTGCGATATTGG - Intergenic
1020311099 7:6869550-6869572 GTGTACACACCCTGCGACATTGG - Intergenic
1020335036 7:7056610-7056632 GTGAACAAACCCTGCGATATTGG - Intergenic
1020335150 7:7057285-7057307 GTGTACACTCCCTGCGATATGGG - Intergenic
1020335451 7:7059010-7059032 GTGTACACCTTCTGCGATATTGG + Intergenic
1020335565 7:7059768-7059790 GTGTACACCCCCTGCGATATTGG + Intergenic
1020335591 7:7059918-7059940 GTGGACACACCTCGCCATATAGG + Intergenic
1020335609 7:7060063-7060085 GTGTACACCCTCTGCAATATAGG + Intergenic
1020335658 7:7060362-7060384 GTGTACACCCTTTGCGATATTGG + Intergenic
1020335729 7:7060811-7060833 GTGTACACTCCCTGCGATATTGG + Intergenic
1020335886 7:7062156-7062178 GTGCACACCCCCTGCGATATTGG - Intergenic
1020336033 7:7063053-7063075 GTGTACACCCACTGCGATATTGG - Intergenic
1020336202 7:7064180-7064202 GTGTACACCCCCTGCGATATTGG - Intergenic
1020336214 7:7064256-7064278 GTGTACACCCACTGCGATATTGG - Intergenic
1020336256 7:7064479-7064501 GTGTACACCCCTTGCAATATTGG - Intergenic
1020336387 7:7065518-7065540 GTGTACACTCCCTGCGATATTGG - Intergenic
1020336671 7:7067548-7067570 GTGTACACCCTCTGTGATATTGG + Intergenic
1020337191 7:7071167-7071189 GGGTACACCCTCTGCGATATTGG - Intergenic
1020337238 7:7071448-7071470 GAGCACACCCTCTGCGATATTGG - Intergenic
1021591192 7:22264611-22264633 GTGGACACATTATGCCAGATGGG - Intronic
1029077798 7:97949868-97949890 GTGTACACACCCTGCGACATTGG - Intergenic
1029077829 7:97950018-97950040 GTGAACACTCCCTGCGATATTGG - Intergenic
1029077867 7:97950243-97950265 GTGTACACCCTCTGCGAAATTGG - Intergenic
1029077981 7:97950850-97950872 GTGTACACACACTTCGATATTGG - Intergenic
1029079066 7:97957808-97957830 GTGTACACTTTCTGCGATATTGG + Intergenic
1029300984 7:99582267-99582289 GTGTACACTCCCTGCGATATTGG + Intronic
1029301030 7:99582494-99582516 GTGTACATTCTCTGCGATATTGG + Intronic
1029301042 7:99582569-99582591 GTGTACACCCCCTGCGATATTGG + Intronic
1029301094 7:99582873-99582895 GTGTACACCTTCTGCGATATTGG + Intronic
1029301180 7:99583330-99583352 GTGTACACCCTCTGCGATATTGG + Intronic
1029301191 7:99583406-99583428 GTGTACACCCTTTGGGATATTGG + Intronic
1029301218 7:99583557-99583579 GTGTACACCTTCTGCGATATTGG + Intronic
1029301283 7:99583928-99583950 GTGTACACCCTCTGCGATATTGG + Intronic
1029301316 7:99584082-99584104 GTGTACACGCTCTGTGATATTGG + Intronic
1029301425 7:99584757-99584779 GTGGACACCCCCTGCGATATTGG + Intronic
1029301537 7:99585584-99585606 GTGTACACGCTTTGCCATATTGG + Intronic
1029301716 7:99586612-99586634 GTGTACACCCCCTGCGATATTGG + Intronic
1029301832 7:99587291-99587313 GTGTACACCCCCTGCGATATTGG + Intronic
1029342835 7:99958668-99958690 GTGTACACTCCCTGCGATATTGG - Intergenic
1029342866 7:99958879-99958901 GTGTACACCCTCTGCCATATGGG - Intergenic
1029342920 7:99959177-99959199 GTGTACACTCCTTGCAATATGGG - Intergenic
1029342938 7:99959302-99959324 GTGTACACCCTCTGCGATATTGG - Intergenic
1029343075 7:99960101-99960123 GTGTACACACCTTGTGATATAGG - Intergenic
1029343320 7:99961606-99961628 GTGTACACTTTTTGAGATATTGG - Intergenic
1029343431 7:99962247-99962269 GTGTACACCCTCTTCGATATTGG - Intergenic
1029343443 7:99962323-99962345 GTGTACACCCTCTGCAATATTGG - Intergenic
1029343538 7:99962927-99962949 GTGTACACCCCCTGCGATATTGG - Intergenic
1029343671 7:99963692-99963714 GTGTACATACTCTGCAATATTGG - Intergenic
1036238814 8:7065454-7065476 GTGTACACCTTCTGCGATATGGG + Intergenic
1036239168 8:7068108-7068130 GTGTACACCCTCTGCGATATTGG + Intergenic
1036240023 8:7073659-7073681 GTGTACACACACTTCGATATTGG + Intergenic
1036240337 8:7075407-7075429 GTGTACACACCCTGCGATATTGG + Intergenic
1036240383 8:7075705-7075727 GTGTACACCCCCTGCGATATTGG + Intergenic
1036817631 8:11913754-11913776 GTGTACACCCCCTGCGATATTGG - Intergenic
1036819837 8:11931721-11931743 GTGTACACCCTCTGCGATATTGG - Intergenic
1036819977 8:11932578-11932600 GTGTACACACACTTCGATATTGG - Intergenic
1036820579 8:11936370-11936392 GTGTACACCCCCTGCGATATTGG - Intergenic
1036833023 8:12036746-12036768 GTGGAAACCCTCTGCGATACTGG - Intergenic
1036903161 8:12687093-12687115 GTGTACACCCCCTGCGATATTGG - Intergenic
1036903299 8:12687922-12687944 GTGTACACACACTTCGATATTGG - Intergenic
1036905631 8:12706608-12706630 GTGTACACGCCCTGCGATATTGG - Intergenic
1038637365 8:29298805-29298827 GTGTACACACTTTGCAATATTGG - Intergenic
1038637466 8:29299469-29299491 GTGTGCACCCTTTGCAATATTGG - Intergenic
1038637583 8:29300222-29300244 GTGTACATTCTCTGCGATATTGG - Intergenic
1038637679 8:29300628-29300650 GTGAACACCCTCTGCGATATGGG + Intergenic
1038637829 8:29301701-29301723 GTGTACACACCCTGCGATATTGG + Intergenic
1038637921 8:29302300-29302322 GTGTACACTCCTTTCGATATTGG + Intergenic
1038638113 8:29303513-29303535 GTGTACACTCCCTGCGATATTGG + Intergenic
1038639580 8:29312617-29312639 GTGTACACTCCCTGCGATATTGG + Intergenic
1043633331 8:82364291-82364313 GTGTACACCCCCTGCGATATGGG - Intergenic
1043633579 8:82365745-82365767 GTGTACACCCCCTGCGATATTGG - Intergenic
1043633614 8:82365973-82365995 GTGTACAGTCTTTGCGATATTGG - Intergenic
1043634246 8:82369752-82369774 GTGTACACTCACTGCGATATTGG + Intergenic
1043634301 8:82370126-82370148 GTGTACACCCCCTGCGATATTGG + Intergenic
1043634330 8:82370273-82370295 GTGTACACCCCCTGCGATATTGG + Intergenic
1043634359 8:82370468-82370490 GTGTACACCCCCTGCGATATTGG + Intergenic
1043634588 8:82372065-82372087 GTGAACACACCCTGCGATATTGG + Intergenic
1043634706 8:82372770-82372792 GTGTACACCCTTTGAGATATGGG + Intergenic
1043634816 8:82373462-82373484 GTGTACACCCTTAGCAATATTGG - Intergenic
1043634856 8:82373685-82373707 GAGTACACCCTTTGCAATATTGG - Intergenic
1043634935 8:82374240-82374262 GTGTACACTCCTTGGGATATTGG - Intergenic
1043635067 8:82375117-82375139 GTGTACACCCCTTGCAATATTGG - Intergenic
1043635296 8:82376434-82376456 GTGTACACGCTCTGCGATATGGG - Intergenic
1043635471 8:82377495-82377517 GTGTACACTCTCTGCGATATTGG - Intergenic
1043635524 8:82377798-82377820 GTGCACAGCCTTTGCGATATTGG - Intergenic
1043635681 8:82378671-82378693 GTGTACACCCTTTGCGTTATGGG - Intergenic
1043635697 8:82378747-82378769 GTGTACATACCCTGCGATATGGG - Intergenic
1043635739 8:82379045-82379067 GTGTACACACCCTGCGATATTGG - Intergenic
1045923842 8:107565027-107565049 GTGTACACTCCCTGCGATATAGG - Intergenic
1045923874 8:107565255-107565277 GCGTACACCCTTTGCTATATTGG - Intergenic
1045923916 8:107565662-107565684 GTGTACACCATCTGCGATATGGG - Intergenic
1045923937 8:107565807-107565829 GTGTACACCCTTTGCAAAATGGG - Intergenic
1045924006 8:107566257-107566279 ATGAACCCCCTTTGCGATATGGG - Intergenic
1045924168 8:107567271-107567293 GTGTACACACCCTGCAATATGGG - Intergenic
1045924354 8:107568551-107568573 GTGTGCACCCTCTGCGATATTGG - Intergenic
1045924569 8:107569905-107569927 GTACACACCCTCTGCGATATTGG - Intergenic
1045924579 8:107569981-107570003 GTGTACACCTTCTGCGATATTGG - Intergenic
1045924627 8:107570285-107570307 GTGTACACTCTCTGCGACATTGG - Intergenic
1045924737 8:107571032-107571054 GTGTACACGCTATGCGATATTGG - Intergenic
1045924869 8:107571837-107571859 GTGTACACCCTCTGAGATATTGG - Intergenic
1045924903 8:107572064-107572086 GTGTTCACCCTTTGCAATATTGG - Intergenic
1045924931 8:107572294-107572316 GTGTACACACCCTGCGATATTGG - Intergenic
1045925062 8:107573071-107573093 GTGTACACCCCCTGCGATATTGG - Intergenic
1045925173 8:107573824-107573846 GTGTACATCCTCTGCGATATTGG - Intergenic
1045925180 8:107573900-107573922 GTGTAGACTCTCTGCGATATTGG - Intergenic
1045925276 8:107574617-107574639 GTGTACACAGTCTTCGATATTGG - Intergenic
1045925326 8:107574920-107574942 GTGTACACCCCCTGCGATATTGG - Intergenic
1045925524 8:107576133-107576155 GTATACACCCTCTGCGATATTGG - Intergenic
1045925778 8:107577799-107577821 GTGGACACCCCCTGCGATATTGG - Intergenic
1045925803 8:107577952-107577974 GTGTACACATTCTGCGATATTGG - Intergenic
1045925893 8:107578561-107578583 GTGTACACCCTCTGCGATATTGG - Intergenic
1045925983 8:107579155-107579177 GTGTACACCCTCTGCAATATTGG - Intergenic
1045925994 8:107579228-107579250 GTGTACACCCTCTGCGACATTGG - Intergenic
1045926033 8:107579569-107579591 GTGGATACTCCTTGCGATATTGG - Intergenic
1045926320 8:107581623-107581645 GTGTACACACCCTGCGATATTGG - Intergenic
1045926380 8:107582002-107582024 GTGTACACCTTCTGCGATATTGG + Intergenic
1045926471 8:107582664-107582686 GTGTACACCTCTTGCGATATTGG + Intergenic
1045926564 8:107583249-107583271 GTGTACACTCTTTGTGAAATTGG + Intergenic
1045926799 8:107584864-107584886 GTGTACACCCCCTGCGATATTGG + Intergenic
1045926907 8:107585540-107585562 GTTTACACACTCTGCGATATTGG + Intergenic
1045926965 8:107585854-107585876 GTGTACACCCTCTGCGATATTGG + Intergenic
1045927084 8:107586676-107586698 ATGTACACACCCTGCGATATTGG + Intergenic
1045927236 8:107587743-107587765 GTGTACACCCCCTGCGATATTGG + Intergenic
1045927263 8:107587899-107587921 GTGTACACCCCCTGCGATATTGG + Intergenic
1045927366 8:107588545-107588567 ATGTACACCCTCTGCGATATTGG - Intergenic
1045927377 8:107588620-107588642 GTGTACAATCTTTGCGATATTGG - Intergenic
1045927482 8:107589337-107589359 GTGTACACCCCTTGCAATATTGG - Intergenic
1045927520 8:107589626-107589648 GTGTACACGTTTTGCGATATAGG - Intergenic
1045927530 8:107589701-107589723 GTGTATACACTCTGCGATATGGG - Intergenic
1045927569 8:107589927-107589949 GTGTACACCCTTTGTGATATGGG - Intergenic
1045927668 8:107590634-107590656 GTGTACATCCTTTGCGATATGGG - Intergenic
1045927714 8:107590935-107590957 GTGTACACACCCTGCAATATGGG - Intergenic
1045927727 8:107591010-107591032 GTGTGCACCCCTTGCGATATGGG - Intergenic
1048108207 8:131436062-131436084 GTGGAAACACTTCAGGATATTGG + Intergenic
1048921176 8:139231426-139231448 CTGGACACAATTTGCCATAAAGG + Intergenic
1049895153 9:105942-105964 GTGTACACCCCCTGCGATATTGG - Intergenic
1049895208 9:106211-106233 GTGTACACCCCCTGCGATATTGG - Intergenic
1049895383 9:107339-107361 GTGTACACACCCTGTGATATGGG - Intergenic
1050902347 9:10964018-10964040 TTGTACACTCTCTGCGATATTGG + Intergenic
1050902439 9:10964681-10964703 GTGTACACCCTCTGCAATATAGG + Intergenic
1050902550 9:10965397-10965419 GTGTACACTCCCTGCGATATTGG + Intergenic
1050902594 9:10965981-10966003 GTGCACACTTTCTGCGATATTGG - Intergenic
1050902796 9:10967099-10967121 GTGTACACCCCTTGCAATATTGG - Intergenic
1051232048 9:14964620-14964642 GTGTACACCCTCTGCGATATTGG + Intergenic
1051232230 9:14965739-14965761 GTGTACACCCTGTGCCATATTGG + Intergenic
1051232306 9:14966192-14966214 GTGTACACCCTCTGCGATATTGG + Intergenic
1051232394 9:14966798-14966820 GTGTACACCCTCTGCGATATTGG + Intergenic
1051233085 9:14973267-14973289 GTGTACACCCCCTGCGATATTGG + Intergenic
1051233141 9:14973564-14973586 GTGTACACCCCCTGCGATATTGG + Intergenic
1051233156 9:14973642-14973664 GTGAACACTCCCTGCGATATTGG + Intergenic
1051233168 9:14973717-14973739 GTTTACACCCCTTGCGATATTGG + Intergenic
1051233214 9:14974017-14974039 GTGTACACACCCAGCGATATGGG + Intergenic
1051233274 9:14974357-14974379 GTGTACACTTTTTGCGATATGGG + Intergenic
1053737707 9:41111950-41111972 GTGTACACCCCCTGCGATATTGG - Intergenic
1053738088 9:41114286-41114308 GTGTACACTCCCTGCGATATTGG + Intergenic
1053738221 9:41115449-41115471 GTGTACACCCCCTGCGATATTGG - Intergenic
1053738376 9:41116311-41116333 GTGTACACCCCCTGCGATATTGG - Intergenic
1053738547 9:41117439-41117461 GTGTACACACCCTGTGATATGGG - Intergenic
1054353714 9:64042575-64042597 GTGTACACTCACTGCGATATTGG + Intergenic
1054353758 9:64042802-64042824 GTGTACACATCCTGCGATATTGG + Intergenic
1054353934 9:64043912-64043934 GTGTACACTCCTTACGATATTGG + Intergenic
1054689796 9:68313875-68313897 GTGTACACACCCTGTGATATGGG + Intergenic
1054689974 9:68315004-68315026 GTGTACACCCCCTGCGATATTGG + Intergenic
1054690261 9:68317032-68317054 GTGTACACTCCCTGCGATATTGG - Intergenic
1054690642 9:68319369-68319391 GTGTACACCCCCTGCGATATTGG + Intergenic
1056866047 9:90228152-90228174 GTGTACACACACTTCGATATTGG + Intergenic
1056866192 9:90228981-90229003 GTGTACACTCCCTGCGATATTGG + Intergenic
1056866204 9:90229055-90229077 GTGTACTCCCCTTGCGATATTGG + Intergenic
1056866219 9:90229131-90229153 GTGTACACACCCTGCGACATTGG + Intergenic
1056916804 9:90753778-90753800 GTGTACACACCCTGCGACATTGG - Intergenic
1056916833 9:90753928-90753950 GTGTACACCCCCTGCGATATTGG - Intergenic
1056916978 9:90754754-90754776 GTGTACACACACTTCGATATTGG - Intergenic
1056917985 9:90761168-90761190 GTGTACACCCCCTGCGATATTGG + Intergenic
1056918074 9:90761620-90761642 GTGTACACTTTCTGCGATATTGG + Intergenic
1056918119 9:90762283-90762305 GTGTACACTCCCTGCGATATTGG - Intergenic
1058518143 9:105795745-105795767 GTGTACACCCCCTGCGATATTGG + Intergenic
1058518352 9:105797109-105797131 GTGTACAAACTCTGCGATATTGG + Intergenic
1058518519 9:105798227-105798249 GTGTAGACTCTCTGCGATATTGG + Intergenic
1058518532 9:105798302-105798324 GTGCACACCCTCTGCAATATTGG + Intergenic
1058518544 9:105798378-105798400 GTGTACACATTCTGCGACATTGG + Intergenic
1058518696 9:105799275-105799297 GTGTACACACCCTGCGATATTGG + Intergenic
1058518732 9:105799502-105799524 GTGTACACCCCCTGCGATATTGG + Intergenic
1058518836 9:105800117-105800139 GTGTACACTCCCTGCGATATTGG + Intergenic
1058518884 9:105800417-105800439 GTGTACACCCCCTGCGATATTGG + Intergenic
1058518916 9:105800565-105800587 GTGTACACCCTCTGTGATATTGG + Intergenic
1058518987 9:105801094-105801116 GTGTACACCTTCTGCGATATTGG + Intergenic
1058519041 9:105801443-105801465 GTGTACACCCTCTTCGATATTGG + Intergenic
1058519090 9:105801739-105801761 GTGTACACACACTGCGATATTGG + Intergenic
1058519234 9:105802652-105802674 GTGTACACACTCTGAGATATTGG + Intergenic
1058519415 9:105803790-105803812 GTGTACACACCCTGTGATATTGG + Intergenic
1058519498 9:105804391-105804413 GTGTACACCCTCTGCAATATTGG + Intergenic
1058519899 9:105806927-105806949 GTGTACACCCCCTGCGATATTGG + Intergenic
1058520205 9:105808881-105808903 GTGTACACACCCTGCGATATGGG - Intergenic
1058520345 9:105809749-105809771 GGGAACACCCTTTGAGATATTGG - Intergenic
1058520358 9:105809823-105809845 GTGTACACCCCCTGCGATATTGG - Intergenic
1058520565 9:105811141-105811163 GTGTACACCCCCTGCGATATTGG - Intergenic
1058521091 9:105814793-105814815 TTGTACACTCTCTGCGATATTGG + Intergenic
1058521111 9:105814937-105814959 GTGTACACCCATGGCGATATTGG + Intergenic
1058521683 9:105818803-105818825 GTGTACACCCCTTGCAATATTGG - Intergenic
1058522146 9:105822150-105822172 GTGTACACTTTCTGCGATATTGG - Intergenic
1203695621 Un_GL000214v1:94631-94653 GTGTACACCCACTGCGATATTGG - Intergenic
1203742043 Un_GL000218v1:11684-11706 GTGTACACCCACTGCGATATTGG + Intergenic
1203742091 Un_GL000218v1:11912-11934 GTGTACACATCCTGCGATATTGG + Intergenic
1203743136 Un_GL000218v1:19346-19368 GTGCACACCCTCTGTGATATTGG + Intergenic
1203702241 Un_KI270742v1:6274-6296 GTGTACACCCACTGCGATATTGG + Intergenic
1203702462 Un_KI270742v1:7611-7633 GTGTACACTCCTTACGATATTGG + Intergenic
1203703375 Un_KI270742v1:14083-14105 GAGTACACCCTCTGCGATATTGG + Intergenic
1203566956 Un_KI270744v1:100093-100115 GAGAACACCCTCTGCGATATTGG - Intergenic
1203640652 Un_KI270751v1:9432-9454 GTGTACACCCACTGCGATATTGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1191696181 X:63993236-63993258 GTGGACAAATTTTTCAATATGGG - Intergenic
1192880974 X:75284109-75284131 TTGGACATACTTTTAGATATGGG - Intronic
1196219022 X:113089237-113089259 TTGGACACACTTTTAGAAATTGG + Intergenic
1201155574 Y:11129160-11129182 GTGTACACCCACTGCGATATTGG + Intergenic
1201155621 Y:11129388-11129410 GTGTACACATCCTGCGATATTGG + Intergenic
1201155805 Y:11130497-11130519 GTGTACACTCCTTACGATATTGG + Intergenic
1201156665 Y:11136813-11136835 GTGCACACCCTCTGTGATATTGG + Intergenic