ID: 1078832660

View in Genome Browser
Species Human (GRCh38)
Location 11:14992155-14992177
Sequence ATGTACACCCACTGCCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2093
Summary {0: 1, 1: 24, 2: 160, 3: 549, 4: 1359}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078832660_1078832666 12 Left 1078832660 11:14992155-14992177 CCAATATGGCAGTGGGTGTACAT 0: 1
1: 24
2: 160
3: 549
4: 1359
Right 1078832666 11:14992190-14992212 ATTGTTTCTAATATACAAGAGGG 0: 1
1: 4
2: 82
3: 296
4: 1158
1078832660_1078832665 11 Left 1078832660 11:14992155-14992177 CCAATATGGCAGTGGGTGTACAT 0: 1
1: 24
2: 160
3: 549
4: 1359
Right 1078832665 11:14992189-14992211 TATTGTTTCTAATATACAAGAGG 0: 1
1: 18
2: 134
3: 629
4: 1515
1078832660_1078832667 17 Left 1078832660 11:14992155-14992177 CCAATATGGCAGTGGGTGTACAT 0: 1
1: 24
2: 160
3: 549
4: 1359
Right 1078832667 11:14992195-14992217 TTCTAATATACAAGAGGGAGAGG 0: 1
1: 1
2: 2
3: 52
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078832660 Original CRISPR ATGTACACCCACTGCCATAT TGG (reversed) Intronic
Too many off-targets to display for this crispr