ID: 1078834663

View in Genome Browser
Species Human (GRCh38)
Location 11:15015769-15015791
Sequence TCTCCTGGATGATATCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 42, 2: 57, 3: 38, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078834663_1078834670 19 Left 1078834663 11:15015769-15015791 CCAGCAGGATATCATCCAGGAGA 0: 1
1: 42
2: 57
3: 38
4: 153
Right 1078834670 11:15015811-15015833 ACAGGCCAACATTCAAATTCAGG 0: 1171
1: 3836
2: 3846
3: 2844
4: 1009
1078834663_1078834665 1 Left 1078834663 11:15015769-15015791 CCAGCAGGATATCATCCAGGAGA 0: 1
1: 42
2: 57
3: 38
4: 153
Right 1078834665 11:15015793-15015815 CTTCCCCAACCTATCAAGACAGG 0: 11
1: 904
2: 2360
3: 5563
4: 2224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078834663 Original CRISPR TCTCCTGGATGATATCCTGC TGG (reversed) Intronic
901179620 1:7332280-7332302 CCTCCTGGATGACATTCTGGAGG - Intronic
901379948 1:8866351-8866373 TCTCCTTGATGACATTCTTCAGG + Exonic
904328500 1:29743099-29743121 TCTCCTGGATGTCTGCCTGCTGG + Intergenic
904897912 1:33831084-33831106 TCTCCTGGATAGTATCCTGCAGG - Intronic
905161555 1:36039852-36039874 AGTCCTGGATGATCTCCTGTCGG - Exonic
908010085 1:59767194-59767216 TTTCCTGTATGATATCCTATGGG + Intronic
910291255 1:85602546-85602568 TCTGCTGCATGATACCATGCAGG + Intergenic
910485351 1:87707448-87707470 TGTCATGGATGATATTCAGCTGG - Intergenic
911342221 1:96652844-96652866 TCTCCTGGATAATATCCTGAAGG - Intergenic
912495703 1:110089833-110089855 CATCCTGGGTCATATCCTGCGGG + Intergenic
915626514 1:157117417-157117439 TCTCCCTGGTGATACCCTGCAGG + Intergenic
916611669 1:166397819-166397841 TCTGCTGGATGAGATACTGATGG + Intergenic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
918519946 1:185404381-185404403 TCTGCTGGTCGATAGCCTGCTGG - Intergenic
918802093 1:188985539-188985561 TCTCCTGGATAATATCCTGAAGG + Intergenic
918955392 1:191200286-191200308 TCCCCTGCATAATATCCTGAAGG - Intergenic
919739986 1:200975495-200975517 CCACCTGGATGAGCTCCTGCTGG + Exonic
920027341 1:203008749-203008771 TCTCATGGATGCTTTCCTCCTGG - Exonic
921385130 1:214561008-214561030 TCTCCTGGAGGAGATGCCGCAGG - Intergenic
921626354 1:217381220-217381242 TCTGCTGGATAATATCCCGAAGG - Intergenic
921842279 1:219840896-219840918 TCTCCTGGATAATATCCTGAAGG - Intronic
921846465 1:219888266-219888288 TCTCCTGGATAATATCCTGAAGG - Intronic
923027881 1:230220472-230220494 TCTTCAGCTTGATATCCTGCAGG + Intronic
923200132 1:231703417-231703439 TCTCATAGATGAAATCCAGCAGG - Intronic
923723066 1:236483737-236483759 TCTCCTTGATGACATTCTTCAGG - Intronic
1063338151 10:5236343-5236365 TCTTCTGGATAATATCCTGAAGG - Intergenic
1063792728 10:9472823-9472845 ACTTCTGGATGATATCCAGATGG + Intergenic
1064150264 10:12857201-12857223 TTTCCTGGATAATATCCTGAAGG - Intergenic
1065174191 10:23061151-23061173 TCTCATGGCTAAGATCCTGCAGG - Intergenic
1066340122 10:34524184-34524206 TCTCCTGCATGATATTTTGCTGG - Intronic
1066699038 10:38106928-38106950 TCTCCTGGATAATATCCTGAAGG - Intronic
1066993326 10:42538276-42538298 TCTCCTGGATAATATCCTGAAGG + Intergenic
1069093319 10:64228553-64228575 TCTTCTGGATAATATCCTGAAGG + Intergenic
1070455460 10:76610070-76610092 TCTCCTGGATAATATCCTGAAGG - Intergenic
1071323613 10:84490308-84490330 TCTCCTGGATAATATCTTGCAGG + Intronic
1071459462 10:85878193-85878215 TCTCCTGGATAATACCCTGCAGG - Intronic
1072024622 10:91442651-91442673 TCTCCTGGATAATATCCTGAAGG + Intronic
1072025075 10:91446944-91446966 TCTCCTGGATAATATCCTGAAGG - Intronic
1072854678 10:98934851-98934873 TGCCCTGGATGATATCCTGAAGG + Intronic
1077050243 11:563239-563261 TCTGCTGGATGAACTGCTGCAGG - Exonic
1077481902 11:2818871-2818893 TCTCCTAGATGTGATTCTGCTGG - Intronic
1077907238 11:6544131-6544153 TTTCCTGGATGGAATCCTGCAGG - Exonic
1078834663 11:15015769-15015791 TCTCCTGGATGATATCCTGCTGG - Intronic
1081984236 11:47290029-47290051 CATCCGGGATGATGTCCTGCCGG - Exonic
1082596303 11:55085942-55085964 TCTCTGGGATAATATCGTGCAGG - Intergenic
1082618709 11:55394959-55394981 TCTCCTTGAAGAGATCCTTCAGG + Intergenic
1082876957 11:57998729-57998751 TCTCCTGGATAATATCCTGCCGG + Intergenic
1084175195 11:67419222-67419244 GGCCCTGGGTGATATCCTGCAGG + Exonic
1084856160 11:71988320-71988342 TTTCCTGGATGAAATACTGGTGG + Intronic
1085702441 11:78756917-78756939 TCTCCTGGATGATGTCCAGAGGG + Exonic
1086129369 11:83384544-83384566 TCTCCTGGATAATATCCTGAAGG - Intergenic
1087561354 11:99794910-99794932 TGTCCTGTATAATATCTTGCAGG + Intronic
1091354435 11:134924737-134924759 TCTCCTGGATGAGATGCTGGAGG - Intergenic
1093318678 12:17684593-17684615 TATCCTGGATAATATTCTGGAGG - Intergenic
1094758020 12:33494146-33494168 TCTCCTGGATAATATCCTGAAGG - Intergenic
1095186760 12:39209304-39209326 TCTCCTGGATAATGTCCTGAAGG - Intergenic
1095483272 12:42657935-42657957 TCGCCTGGATAATATCCTGTGGG + Intergenic
1096044753 12:48552767-48552789 TCTCCTGGATAATATCCTGCAGG + Intergenic
1096931216 12:55211991-55212013 CCTCCTGGATAATATCCTGCAGG - Intergenic
1098680707 12:73349921-73349943 TCTCCTGGATAATATCCTGAAGG + Intergenic
1101552739 12:105777503-105777525 TCTCCTGGATAATATCCTGCAGG - Intergenic
1105021381 12:132818834-132818856 TCTGCTTGATGACAGCCTGCTGG + Intronic
1105323713 13:19351420-19351442 CCTCCTGGATGATGGCATGCAGG + Intergenic
1105782804 13:23719202-23719224 TCTGTTGTATGATATCCAGCTGG - Intergenic
1109034011 13:57231499-57231521 TCTCCTGGATAATATCCTAAAGG - Intergenic
1109188070 13:59293272-59293294 TCTATTGGATAATATCCTGAAGG - Intergenic
1110818678 13:79888627-79888649 TCTCCTGGATAATATCCTGAAGG - Intergenic
1110850823 13:80242393-80242415 TCTTCTGGAATATCTCCTGCGGG - Intergenic
1111056199 13:82953807-82953829 TATCCTGGATAATATCCTGAAGG + Intergenic
1111262512 13:85760512-85760534 TCTGCTGGTTGATGGCCTGCTGG + Intergenic
1111269072 13:85856175-85856197 TCTCCTGGAATATATCCTGAAGG + Intergenic
1111516532 13:89339521-89339543 TCTCCTGGAAGATACTCAGCAGG - Intergenic
1113276784 13:108739704-108739726 TCTTCTGGATAATATCCTGCAGG + Intronic
1114562311 14:23602258-23602280 TCTCCTTGATGATAAGCTACAGG + Intergenic
1116602851 14:46949264-46949286 TCTTCTGGATGATGTACTGTGGG - Intronic
1117859531 14:60075034-60075056 TCTCCTGGATAATATCCTGAAGG - Intergenic
1117900492 14:60527820-60527842 TCTCCTGGATAATATCCTGAAGG + Intergenic
1118104101 14:62638115-62638137 TCTCCTGGATAATATCCTGCAGG - Intergenic
1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG + Intergenic
1120553952 14:85906485-85906507 TCTCCTGGATAATATCCTGAAGG + Intergenic
1124572949 15:30882913-30882935 TCTCATGGATGCTTTCCTCCTGG + Intergenic
1124724532 15:32144483-32144505 TCTCCTGGATAATATCCTGAAGG + Intronic
1126168730 15:45676181-45676203 GCTCCTGGATGATCTCCTGCAGG - Exonic
1126264901 15:46742588-46742610 TCTCCTGGATAATATCCCGAAGG - Intergenic
1126554247 15:49967697-49967719 TCTCCTGGATAATATCCTGAAGG - Intronic
1127049449 15:55065428-55065450 TCTCCTGGATAATATCCTGCAGG - Intergenic
1129530274 15:76259666-76259688 TCTCCTGGAAGATCTACAGCGGG - Intronic
1129954498 15:79622848-79622870 TTTCATAGATGATATCCTGAAGG + Intergenic
1130794913 15:87197607-87197629 TCTCCTGAAAGAGATCCTGGTGG + Intergenic
1131905629 15:97138988-97139010 TTTCCTGGATGCTCTGCTGCAGG + Intergenic
1134213582 16:12298343-12298365 TCCCCTGGATGGTTTTCTGCAGG + Intronic
1137326166 16:47439258-47439280 TCTCCTGGATAATATCCTGCAGG - Intronic
1144148506 17:12420926-12420948 TCCCCTGGGTGATCTCCTCCAGG - Intergenic
1145861367 17:28213149-28213171 TCTCCTGGATAATATCCTCAAGG - Intergenic
1146561231 17:33872089-33872111 CCTCCTGGCTGATATCTGGCTGG - Intronic
1149145546 17:53487942-53487964 TCTCCTGGCTCATCTCCTTCAGG + Intergenic
1150094252 17:62358522-62358544 TCTCCTGGATTATATTCTCAAGG - Intergenic
1150440924 17:65190731-65190753 TCTCCTAGATGATGTCCTATGGG - Intronic
1151745197 17:76008182-76008204 TCTCCTGGCTGAGCTCCTCCCGG + Exonic
1152547362 17:81008242-81008264 TCTCGAGGATGATGTCCCGCAGG + Intronic
1153954596 18:10085687-10085709 TTTTCTGGATGATATAATGCAGG + Intergenic
1154320527 18:13347640-13347662 TCTTCTGGATAATATCCTGCAGG + Intronic
1156855499 18:41776452-41776474 TCTCCTGGATAATATCCTGCAGG - Intergenic
1157891967 18:51426528-51426550 TCTCTTGCATGAGTTCCTGCAGG + Intergenic
1158168882 18:54574067-54574089 TCTCCTGGATAATATCCTGCAGG + Intergenic
1158407182 18:57170222-57170244 CCTCCTGGATGATTTCCTCAAGG - Intergenic
1159645634 18:70915334-70915356 TCTCCTGGATAACACCCTGGAGG + Intergenic
1163995882 19:21046901-21046923 TCTTCTGGATGATATCCTGAAGG + Intronic
1164246480 19:23434700-23434722 TCTCCTGGATAATATCCTGCAGG + Intergenic
1166090306 19:40504075-40504097 TCTCCTGGAAGACCTTCTGCAGG - Exonic
1166179816 19:41100077-41100099 TCACCTGCATTATATCCTGAAGG - Intergenic
1167301505 19:48680491-48680513 ACTCCTGGAGGATCTCCTGGCGG - Intergenic
1167305061 19:48703436-48703458 ACTCCTGGAGGATCTCCTGGCGG - Exonic
1168165310 19:54543152-54543174 TCTCATGGACCATCTCCTGCAGG - Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
926943812 2:18166754-18166776 TCTCCTGGATAATATCCTGAAGG + Intronic
927280215 2:21298415-21298437 TTTCCCGGATGGTATCCTGTGGG + Intergenic
928127456 2:28626421-28626443 TCTCCAGGTTGATGTCCTGAGGG - Exonic
928233419 2:29519793-29519815 TCTGCTGGATGTTCACCTGCAGG - Intronic
930290012 2:49481898-49481920 TCTCCTGGATAATATCCTGCAGG - Intergenic
932113001 2:69018351-69018373 ACACCTGGATGATGCCCTGCTGG + Intronic
933703362 2:85272079-85272101 CCTCCTGGGTGAGAACCTGCAGG + Intronic
935245781 2:101217933-101217955 TCCCCTGGACGAAATCCTTCAGG - Intronic
935882195 2:107575839-107575861 TCTGCTGGTTGATGGCCTGCTGG - Intergenic
937147925 2:119663358-119663380 TCTCCTGGAGGACATCTTGCAGG + Intergenic
939072132 2:137556115-137556137 TCTCCTGGATAATATCCTGCAGG - Intronic
939289713 2:140178370-140178392 TATCCTGTATGCTATCATGCTGG - Intergenic
939374184 2:141342796-141342818 TCTCCTGGATAATATCCTGAAGG - Intronic
940080436 2:149795178-149795200 TCTCCTGGATAATATCCTGCAGG + Intergenic
941239230 2:163016182-163016204 TCTCCTGCATAATATCCTGAAGG + Intergenic
942201441 2:173575519-173575541 TCTCCTGGGTGACATCATGAGGG + Intergenic
942958573 2:181803115-181803137 TCTCCTGGATAATATCCTGAAGG + Intergenic
943233865 2:185292503-185292525 TCTCCTGGATAATATCCTGAAGG - Intergenic
947086200 2:226455502-226455524 TCTCCTGGATAATATCCTGAAGG - Intergenic
947754881 2:232554855-232554877 TCTCCTGGATGAAATGCTGAGGG + Intronic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
948634728 2:239327849-239327871 TCTGCTGGATGTTAGCTTGCAGG - Intronic
1171194157 20:23184456-23184478 TCTCCTGGACAATACCCTGAAGG + Intergenic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1175535030 20:59704421-59704443 TCTCCTGGATTATTTTCTTCTGG + Intronic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1178898935 21:36583726-36583748 TCCCCTGGATGGGATCCTGTGGG - Intergenic
1179667286 21:42921613-42921635 TCTCCTTGATGATCTGCTCCTGG - Intergenic
1181454880 22:23053457-23053479 TCTTCTGGGTGTCATCCTGCTGG - Intergenic
1182392798 22:30013334-30013356 TCTCCTGGATGCTTCCCTGCAGG + Exonic
1182928482 22:34150464-34150486 TCTCCTGGTTGAAATGCTGATGG - Intergenic
1185277335 22:49955444-49955466 TCTCCCTGCTGAAATCCTGCAGG - Intergenic
1185336316 22:50272209-50272231 TCTCCTGGAAGATGGCCTCCAGG - Intergenic
949456485 3:4244815-4244837 TCTCCTGGATAATATCCTGAAGG + Intronic
950446439 3:13041578-13041600 GCTCCATGATGATCTCCTGCTGG + Intronic
951157658 3:19375174-19375196 TCTCCTGGATAATATCCTGCAGG + Intronic
951311064 3:21126437-21126459 TCTCCTGGATAATATCCTGAAGG - Intergenic
951835173 3:26975443-26975465 TTTGCTGGTTGATTTCCTGCAGG + Intergenic
958761534 3:98314947-98314969 TCTTCTGGAATATATCCTGGAGG - Intergenic
959218400 3:103482742-103482764 TCTCCTGGATAATATCCTGCAGG + Intergenic
959290554 3:104468389-104468411 TCCCCTGGATAATATCCTGAAGG + Intergenic
962989298 3:140564052-140564074 TCTCCTGGATGAAGTGCTGGTGG - Exonic
963575361 3:147054155-147054177 TATGCTGGATGATATCCATCAGG - Intergenic
963709484 3:148730436-148730458 TTTACTAGATGACATCCTGCTGG + Intronic
963828583 3:149982981-149983003 TCTCATGGATGTTTTCCTCCTGG + Intronic
965323746 3:167276667-167276689 TCTCCTGGATAATATCCTGCAGG - Intronic
967481128 3:189974593-189974615 TCTCCTGGATAACGTCCTGTCGG - Exonic
967638772 3:191836026-191836048 TCTCCTGGATAATATCCTGAAGG - Intergenic
968272174 3:197411481-197411503 TCTCCTGGATAATATCCTGCAGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969909026 4:10426676-10426698 TCTCCTGGATAATATCCTGAAGG + Intergenic
970494462 4:16610788-16610810 TCTCCTGGATAATATTGTGAAGG - Intronic
970552771 4:17199693-17199715 TCTCCTGCCTGATAGCCTTCAGG - Intergenic
970864233 4:20740158-20740180 TCTCCTGGATAATATCCTGAAGG - Intronic
971441843 4:26695432-26695454 TCTCCTGGATAATATCCTGCAGG - Intronic
972174705 4:36389088-36389110 TGTCCTGGCTGATAGCCTGTTGG + Intergenic
972255718 4:37353411-37353433 TCTCCTGGATAATATCCTAAAGG + Intronic
973305410 4:48643145-48643167 TTTGCTGGATGAGGTCCTGCAGG - Intronic
975154673 4:71058402-71058424 TCTCCTGGATAATATCCTGCAGG + Intergenic
976837396 4:89390767-89390789 TCTCCTGGATAATATCCTGCAGG - Intergenic
977110159 4:92943138-92943160 TCTCCTGGATAATATCCTGCAGG + Intronic
977183228 4:93903914-93903936 TCTCCTGGATGTAGTGCTGCTGG - Intergenic
977668884 4:99672382-99672404 TCTCCTGGATGATATACTGACGG - Intergenic
979140156 4:117162465-117162487 TCTGCTGGTTGATGGCCTGCAGG - Intergenic
981618262 4:146665048-146665070 TCTCCTGGATAATATCCTGCAGG - Intergenic
982651089 4:158088812-158088834 TCTCCTGGATAATATCCTGCAGG + Intergenic
983173101 4:164558065-164558087 TCTCCTGGATAATATCCTGCAGG + Intergenic
983326724 4:166266961-166266983 TCTCCTGGATAATATCCTGCAGG - Intergenic
983716464 4:170787555-170787577 TCTCCTGGATAATATCCTGCAGG + Intergenic
983879211 4:172913815-172913837 TCTCCTGAATAATATCCTGAAGG - Intronic
983896065 4:173083393-173083415 TCTCCTGGATAATTTCCTGAAGG + Intergenic
987118616 5:14745998-14746020 GCTCCTGGAGGACTTCCTGCTGG - Intronic
987593208 5:19960499-19960521 TCTCCTGGAATATCTCCTGAAGG + Intronic
990334882 5:54762806-54762828 TCTCCTAGATTATATACTGGTGG - Intergenic
990369051 5:55098094-55098116 TCTCCTGGATAATATCCTGAAGG - Intergenic
990837970 5:60043369-60043391 TCTACTGGATAATATCCTGAAGG - Intronic
991396779 5:66212115-66212137 TATCCTGGATAATATCCCTCAGG - Intergenic
991538959 5:67705232-67705254 TCTCCTGGATTATATCCTGCAGG - Intergenic
991543817 5:67759110-67759132 TCTCCTGGATAATATCCTGCAGG - Intergenic
991616571 5:68502971-68502993 TCTCCTTTATGAACTCCTGCTGG + Intergenic
992284124 5:75215118-75215140 TCTCCCGGATGATTTCCTGCTGG - Intronic
993380692 5:87203760-87203782 TCTCCTGGATAATATCCTGAAGG + Intergenic
994142694 5:96359901-96359923 TCTCCTGGATAATATCCTGAAGG + Intergenic
994721408 5:103384758-103384780 TCTCCTGGATAATGTCCTTAAGG + Intergenic
995790485 5:115881767-115881789 CCTCCTGGATAATATCCTGAAGG + Intronic
996903897 5:128575864-128575886 TCCCCTGGTCTATATCCTGCAGG - Intronic
997284450 5:132668182-132668204 TCTCCTGGGTGCTGGCCTGCAGG + Intergenic
997915139 5:137917116-137917138 TCTACTTGATGGTGTCCTGCAGG + Intronic
999622738 5:153489389-153489411 TTTCCTGGATCATCTCCTGTTGG + Intergenic
1003113432 6:3267247-3267269 TCTGCTGGAACAGATCCTGCAGG - Intronic
1003115680 6:3282414-3282436 TCTCTTGGATCGTATCCTACAGG - Intronic
1004999747 6:21229042-21229064 TATCCGGGCCGATATCCTGCTGG - Intronic
1005208370 6:23431329-23431351 TCTCCTGGAAAATATCCGGAAGG + Intergenic
1008829183 6:55737094-55737116 TCTCCTGGGTAATATCCTGCAGG - Intergenic
1009264272 6:61533361-61533383 TTTCCTGGATAATATCTTGAAGG - Intergenic
1009290259 6:61871431-61871453 TCTCCTGGATAATATCCTGAAGG - Intronic
1010319050 6:74485441-74485463 TCTCCTGGATAATATCCTGCAGG - Intergenic
1010755538 6:79662714-79662736 TCTCCTGGATAATATCCTGAAGG + Intronic
1011338011 6:86282702-86282724 TCTCCTGGACAATATCCTGTAGG + Intergenic
1013909035 6:115251645-115251667 TCTCCGGGATAATATCCTGCAGG - Intergenic
1013939758 6:115646737-115646759 TCTCCTGGATAATATCCTGAAGG - Intergenic
1014084942 6:117331415-117331437 TCTCCTGGATAATATCCCGAAGG - Intronic
1015291247 6:131540132-131540154 TCTCCTGGATAACATCCTGAAGG - Intergenic
1018331051 6:162727749-162727771 TCTCCTGGGTTAAATCCTCCAGG + Exonic
1022644735 7:32219638-32219660 CCTCCTGGTTGATACCCTGGTGG + Intronic
1024214063 7:47231955-47231977 TTTCTTGCATGAGATCCTGCAGG - Intergenic
1028508045 7:91591215-91591237 TCTCCTGGATAATATCCTGCAGG - Intergenic
1031314468 7:120239398-120239420 TCTCCTGGATAATACCCTGCAGG + Intergenic
1032445827 7:131982909-131982931 TCTCCTGGATAATATCCTGCAGG + Intergenic
1034321228 7:150184578-150184600 TCTCTAGGATGCTGTCCTGCCGG - Intergenic
1034330069 7:150274888-150274910 TCTCCTGGATGACGTTCTGGCGG + Intronic
1034667985 7:152834970-152834992 TCTCCTGGATGACGTTCTGGCGG - Intronic
1034703754 7:153121600-153121622 TCTCCTGGATAATATCCTGCAGG + Intergenic
1034740281 7:153467101-153467123 TCTCCTGAAGGTTCTCCTGCTGG + Intergenic
1035079808 7:156206477-156206499 GCTCCTGAATGTTGTCCTGCCGG - Intergenic
1035641914 8:1190490-1190512 CCTCCTGCATGAGATGCTGCCGG - Intergenic
1035960085 8:4126928-4126950 TCTGCTGGAAGAGACCCTGCAGG + Intronic
1037083379 8:14815499-14815521 ATTCCTGGAAGATATACTGCCGG - Intronic
1037596468 8:20358401-20358423 TGTCCTGGATGGCATCCAGCAGG - Intergenic
1039319449 8:36412686-36412708 TCTCCTGGATAATATCCTGCAGG + Intergenic
1039792154 8:40884618-40884640 TCTGCTGGGTCAAATCCTGCTGG - Intronic
1040472392 8:47745152-47745174 TCTACTTGATGATATCCCACAGG - Intergenic
1041039236 8:53829443-53829465 TATGGTGGATGATATGCTGCAGG - Exonic
1041586235 8:59523382-59523404 TCTGCTGGTTGATGGCCTGCTGG - Intergenic
1043223696 8:77698267-77698289 TCTCCTGGATAATATCTTAAAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045177421 8:99740396-99740418 TCTCCTGGATAATATCCTGCAGG - Intronic
1045200084 8:99971673-99971695 TCTCCTTGAAGATGTCCTTCAGG - Intronic
1046338740 8:112824872-112824894 TTACCTGGATAATATCCTGAAGG + Intronic
1050479285 9:6073311-6073333 TCTGCTGGTTGATGGCCTGCTGG - Intergenic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1051484641 9:17594721-17594743 TCTCCTTGATGGTATCCTCTAGG + Intronic
1051958412 9:22727505-22727527 TCTCCTGGATAATATCCTGCAGG - Intergenic
1052515170 9:29471312-29471334 TCTCCTGGATGGTACTCTGAAGG + Intergenic
1056036135 9:82607834-82607856 ACTCTTGGATGACATTCTGCTGG - Intergenic
1057213167 9:93212371-93212393 TCTCTGGGATGCTGTCCTGCTGG - Intronic
1058224107 9:102338782-102338804 TCTCCTGGATAATATCCTGCAGG - Intergenic
1058374471 9:104306488-104306510 TATCCTGTATAATATCCTGAAGG - Intergenic
1058408624 9:104705030-104705052 TCTCCTGGATGATATCGTGAAGG - Intergenic
1059513526 9:114871254-114871276 TCTCCTGGATAATATCCTGAAGG - Intergenic
1059976600 9:119724557-119724579 TCTCCTGGCTGCCATCCTCCTGG + Intergenic
1061621923 9:131816177-131816199 CATCCTGCATGATACCCTGCTGG + Intergenic
1186354380 X:8774515-8774537 TCTCCTAGGTAATATCCTGAAGG - Intergenic
1187365643 X:18663854-18663876 TCTACGGGAAGATATCCTGTAGG - Intronic
1190120136 X:47652226-47652248 TATCCTGGATGATTTCCACCTGG + Intronic
1190341290 X:49298580-49298602 TCTACTGGATAATATCCTGAAGG + Intronic
1191938836 X:66455397-66455419 TCTCCTGGATAATATCTTGCAGG - Intergenic
1192568523 X:72183166-72183188 TATCCTTGATGTTACCCTGCAGG - Intronic
1192701880 X:73482701-73482723 TCTCCTGGATAATATCCCTAAGG - Intergenic
1192712466 X:73606061-73606083 TCTCCTGGCTTATATCCTGAAGG + Intronic
1192900425 X:75490163-75490185 TCTCCTGGATAATATCCTTCAGG - Intronic
1192948996 X:75996685-75996707 TCTCCTGGCTTATATCTTGAAGG + Intergenic
1192984424 X:76381294-76381316 TCTCCTGGATAATATCCTGAAGG - Intergenic
1193243172 X:79196846-79196868 TCTCCTGGATAATATCCTGAAGG - Intergenic
1193338721 X:80320858-80320880 TCTCGGGGATAATATCCTGATGG - Intergenic
1193510171 X:82389656-82389678 TCTCTTGGATAATATCCTGAAGG - Intergenic
1193528256 X:82620149-82620171 TCTCCTGGATGATACCCTGAAGG - Intergenic
1194958897 X:100213342-100213364 TCTCCTGGAAAATATCGTGAAGG + Intergenic
1195810467 X:108823781-108823803 TCTCCTGGATAATATCCTTATGG + Intergenic
1196474624 X:116068464-116068486 TCTCCTGGATAATATCCTGCTGG + Intergenic
1196944803 X:120813084-120813106 TCTCCTGGATAATATCCTGCAGG - Intergenic
1197649164 X:129045803-129045825 TCTCCTGGATAATATCCTGCAGG - Intergenic
1198382345 X:136095903-136095925 TCTTCTGGAATATGTCCTGCAGG + Intergenic
1198704836 X:139437242-139437264 TCTCCTGCATAATATCCTGCAGG - Intergenic
1199062768 X:143378121-143378143 TCGTCTGAATGATATCTTGCAGG + Intergenic
1200106589 X:153716810-153716832 ACTCCTAGCTGGTATCCTGCAGG - Intronic
1200365250 X:155656165-155656187 TCTCCTGGATAATATACTGAAGG + Intronic
1201541430 Y:15109350-15109372 TCTCCTGGATAATATCCTGAAGG + Intergenic
1201754579 Y:17472284-17472306 TCTGCTTGATGAGATCATGCTGG - Intergenic
1201799216 Y:17936591-17936613 TCTGCTTGATGAGATCATGCTGG - Intergenic
1201802337 Y:17969365-17969387 TCTGCTTGATGAGATCATGCTGG + Intergenic
1201846973 Y:18433701-18433723 TCTGCTTGATGAGATCATGCTGG + Intergenic
1202020666 Y:20461841-20461863 TCTCCTGGGTAATATCCTGATGG + Intergenic
1202041888 Y:20694445-20694467 TCTCCTGGATAGTATCCTGAAGG + Intergenic
1202362452 Y:24125738-24125760 TCTGCTTGATGAGATCCTGCTGG + Intergenic
1202508157 Y:25542755-25542777 TCTGCTTGATGAGATCCTGCTGG + Intergenic