ID: 1078836285

View in Genome Browser
Species Human (GRCh38)
Location 11:15033825-15033847
Sequence TGCAATCTCAAAATAAAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 553}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078836284_1078836285 -5 Left 1078836284 11:15033807-15033829 CCTTAAAATGAGGAAGAGTGCAA 0: 1
1: 0
2: 1
3: 42
4: 283
Right 1078836285 11:15033825-15033847 TGCAATCTCAAAATAAAAGACGG 0: 1
1: 0
2: 1
3: 52
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078836285 Original CRISPR TGCAATCTCAAAATAAAAGA CGG Intronic
900262014 1:1736195-1736217 CTCCATCTCAAAAAAAAAGAGGG + Intronic
900263910 1:1747496-1747518 TTCCATCTCAAAAAAAAACAAGG - Intergenic
901637898 1:10678874-10678896 TGCCATCGCAAAATTAGAGATGG + Intronic
901667066 1:10832076-10832098 TGCTGTCTCAAAAAAAAAAAGGG - Intergenic
901947183 1:12713307-12713329 TACAAGGTCCAAATAAAAGAAGG + Intergenic
902427800 1:16338252-16338274 CTCCATCTCAAAAAAAAAGAGGG + Intronic
902951216 1:19884071-19884093 TGAAATATAAAAATAATAGAGGG + Intronic
905604592 1:39286471-39286493 TGCCATCTCAAAAAAAAAAGGGG - Intronic
906016432 1:42585236-42585258 TTAAATATCAAAATGAAAGAAGG - Intronic
906441066 1:45845330-45845352 TGCAATTTCAAAAAAGAAAAAGG - Intronic
906509453 1:46402516-46402538 CTCCATCTCAAAAAAAAAGAAGG - Intronic
906509549 1:46403134-46403156 TCCCATCTCAAAAAAAAAGACGG - Intronic
906973342 1:50542657-50542679 TGCAATCTCAAACCCAAAGTGGG + Intronic
907068552 1:51511991-51512013 TGCAATTAAAAAATAAAAGTTGG - Intronic
908246593 1:62232217-62232239 TGCAATAAAAAAAAAAAAGAAGG - Intergenic
908928174 1:69282606-69282628 TGCAATTTCGAAGTAAAAGTAGG + Intergenic
909122623 1:71623343-71623365 TGCCATGTCAAAATAAATGGCGG - Intronic
909177566 1:72380278-72380300 TGCAAGTTCAAAATCAAATAGGG + Intergenic
909416243 1:75408953-75408975 TGCTATATGAAAATAAAATAGGG + Intronic
910123708 1:83818052-83818074 TCCAATCTCAACATAAAATTTGG - Intergenic
910475531 1:87602279-87602301 TGCAATGTGAAAATAAAGGGAGG - Intergenic
910955993 1:92705580-92705602 TGCAAGCTCAAAATTCAACAGGG - Intronic
911408907 1:97477315-97477337 TGCAATCTCATGATAAAACATGG - Intronic
911552268 1:99297605-99297627 TGTAAGCTCAAAATAATTGATGG + Intronic
911712585 1:101092140-101092162 TGCAATCTCATTATAAAACTTGG - Intergenic
911936042 1:103973791-103973813 TGGAATCTCAAAAGGAAATAGGG - Intergenic
912036438 1:105323009-105323031 AGCAATATCCACATAAAAGAAGG - Intergenic
912163593 1:107015542-107015564 TCCAATCTCCAAATAACTGAAGG + Intergenic
913441471 1:118902763-118902785 AGAACTCTCAAAAGAAAAGATGG - Intronic
913954858 1:143279924-143279946 TGAAATCCCAAAATAAAAGAGGG + Intergenic
914205637 1:145525254-145525276 TGGAATCTGAAAAAAAAAAAAGG - Intergenic
916804487 1:168244852-168244874 TTCAATCTAAAAAAAAAAAAAGG - Exonic
917594334 1:176513970-176513992 TGCCATCTCAACATGAATGAGGG + Intronic
918105486 1:181412555-181412577 TCCTATCTCAAAAAAAAAAAAGG + Intergenic
918390813 1:184059575-184059597 ATCCATCTCAAAAAAAAAGAAGG - Intronic
919254501 1:195104148-195104170 AGAAATCTCAATATAAAAAATGG - Intergenic
919320845 1:196035710-196035732 TGTCAACTAAAAATAAAAGAGGG - Intergenic
919612019 1:199757242-199757264 TGCAATAAAAGAATAAAAGAAGG - Intergenic
919874738 1:201855960-201855982 TGCACTTTCCAAATACAAGATGG - Intronic
920018156 1:202930323-202930345 TTTATTCACAAAATAAAAGATGG + Intergenic
920027091 1:203006928-203006950 TGAATTCTCAAAATAGGAGAAGG - Intergenic
920894540 1:210032354-210032376 GGCAATCTAAAGGTAAAAGATGG - Intronic
922006807 1:221539454-221539476 TGCCATCTCAAAAGTAGAGATGG + Intergenic
922750190 1:228066564-228066586 TGCAATCTCAGAATTACAGGAGG - Intergenic
923344376 1:233036660-233036682 TGCAATCTTAAAGAAAAAGGAGG - Intronic
924356885 1:243188001-243188023 TGCAATCTGAAAAGAAAAAATGG + Intronic
924634051 1:245767956-245767978 AGCAATATCAACAGAAAAGAAGG + Intronic
1062884585 10:1006630-1006652 TACCATCTCAAAAAAAAAGATGG + Intronic
1062894477 10:1092371-1092393 TTCCGTCTCAAAAAAAAAGAGGG - Intronic
1063320712 10:5050335-5050357 TGAAATTTTAAAATCAAAGAAGG + Intronic
1063564110 10:7157116-7157138 TACAACATCAAAATAATAGATGG - Intergenic
1063581439 10:7311324-7311346 TGAAATGTCACAATGAAAGATGG - Intronic
1063597439 10:7449443-7449465 TGCAGTCTGAAAATATAAAATGG + Intergenic
1064044153 10:11996352-11996374 TTCCATCTCAAAAAAAAAAAAGG - Intronic
1065008479 10:21401332-21401354 CCCCATCTCAAAATAAAAAAAGG - Intergenic
1065073772 10:22055221-22055243 TTCAGTCTTAAAAAAAAAGAAGG - Intergenic
1065397391 10:25253497-25253519 TCCAATCTCAAAGTCAAAGGTGG - Intronic
1065766050 10:29030603-29030625 TGCAATTTGAAAATAAATCAGGG - Intergenic
1065841195 10:29702831-29702853 GGCAACTTCAAAATAAATGAAGG - Intronic
1066195712 10:33097557-33097579 CCCCATCTCAAAATAGAAGAAGG - Intergenic
1068075109 10:52242887-52242909 CTCAGTCTCAAAAAAAAAGAAGG + Intronic
1068686535 10:59875966-59875988 TGCAATCCCAAAAAAAATAACGG + Intronic
1069320733 10:67168127-67168149 CTCCATCTCAAAATAAAAAAAGG + Intronic
1071452721 10:85813033-85813055 TTCAATCTGAAGAGAAAAGAAGG + Intronic
1072263428 10:93704193-93704215 TGCTGTCTCAAAGTAAAAAATGG - Intergenic
1072357274 10:94624077-94624099 CCCTATCTCAAAATAAAATAAGG + Intergenic
1072372754 10:94781505-94781527 TACAATCTTGAAATATAAGATGG - Intronic
1073038701 10:100583604-100583626 TGCAATCTCAAAATCCCAGCAGG - Intergenic
1073708982 10:106017492-106017514 TACAAGGTCCAAATAAAAGAAGG + Intergenic
1073738013 10:106372038-106372060 TGCTGTCTCAAAAAAAAAGGCGG + Intergenic
1074538810 10:114347796-114347818 TACCATCACAAAAAAAAAGAAGG - Intronic
1075240640 10:120775373-120775395 TTCTATCTCAAAAAAAAAAAAGG - Intergenic
1077787610 11:5401669-5401691 AGCAATCCCAAAATAAGATATGG - Intronic
1078161924 11:8847959-8847981 TGCTATCTAAAAACAACAGAAGG + Intronic
1078836285 11:15033825-15033847 TGCAATCTCAAAATAAAAGACGG + Intronic
1079524554 11:21369199-21369221 TGCAAGCTAAAAATAACAGATGG - Intronic
1080007945 11:27429474-27429496 TTCCATCTCAAAAAAAAAAAAGG + Intronic
1080075735 11:28146244-28146266 TGCAAGATCAAAAGGAAAGAGGG - Intronic
1080236089 11:30070050-30070072 TTCAATCTCAATTTCAAAGACGG + Intergenic
1080752235 11:35161411-35161433 TGCAATCTCACAATACAATGAGG + Intronic
1080978418 11:37370507-37370529 TGGAGTCTCAAAACAAAGGATGG + Intergenic
1081769640 11:45641147-45641169 CTCCATCTCAAAAAAAAAGAAGG + Intergenic
1082712850 11:56575809-56575831 TGAAAACTCAAAAAAAAAAAAGG + Intergenic
1082760499 11:57122519-57122541 TGCAATCTCTTAAAAAAAGATGG - Intergenic
1083840861 11:65303513-65303535 CTCAGTCTCAAAAAAAAAGAGGG + Intronic
1083907656 11:65683974-65683996 TTCCATCTCAAAATAAAAACAGG + Intergenic
1084632022 11:70359098-70359120 TGCCCTTGCAAAATAAAAGAAGG + Intronic
1084775160 11:71370072-71370094 TGCAGTCTGAAAACAAAAGACGG + Intergenic
1085185948 11:74576385-74576407 CTCCATCTCAAAAAAAAAGATGG - Intronic
1086011543 11:82109743-82109765 AGATATCTCAAATTAAAAGAAGG - Intergenic
1087155746 11:94901091-94901113 TGCAATCTCATAATACAACTTGG - Intergenic
1087229891 11:95648797-95648819 TGCCACCTCAAAATAAAAACAGG - Intergenic
1088621843 11:111692882-111692904 TTCAATTTCAATATACAAGATGG - Intronic
1088951161 11:114571487-114571509 GGCAATCCCAAAATAAAAGGAGG + Intronic
1089539926 11:119183612-119183634 TGGAATCTCCAAGTTAAAGATGG + Exonic
1089919809 11:122197975-122197997 TGGACACTCAAAATAAAAGTTGG + Intergenic
1089954096 11:122554839-122554861 TACAAGGTCAGAATAAAAGAAGG - Intergenic
1090067214 11:123513380-123513402 TGCAACCTTAAAAAAAAAAAGGG - Intergenic
1090468556 11:126957561-126957583 TGCAATTTCTAAGTCAAAGAAGG + Intronic
1090540197 11:127693642-127693664 TGCAATGTTAAAAGAAAAGATGG - Intergenic
1090641362 11:128731686-128731708 TGAAATCTTAAAATAGGAGACGG - Intronic
1091126430 11:133103326-133103348 TTTAATCTCAAAATACAACATGG - Intronic
1091413606 12:260896-260918 TGTAATATAAAAATAAAAGCCGG + Intronic
1092155189 12:6277885-6277907 TGCACTCTTACAATAAAGGAAGG + Intergenic
1093040091 12:14368954-14368976 TCCTATCTCAAAAAAAAAAAGGG - Intronic
1093662185 12:21769828-21769850 TGCAATCTCATGATAAAACTTGG + Intronic
1093821300 12:23621623-23621645 TGTGATTTCAAAGTAAAAGAAGG + Intronic
1094879574 12:34704252-34704274 TGGAAATTCAAAAAAAAAGAGGG - Intergenic
1095569343 12:43665497-43665519 TGCCATCACAAAAAAAAAGGAGG + Intergenic
1095904541 12:47364225-47364247 TGCAGTCTGAAAATACAAAATGG - Intergenic
1096166644 12:49431048-49431070 TCCAATGTCAAAATATAAAAAGG + Intronic
1096440501 12:51638919-51638941 TGCAATCTCATGATAAAACTTGG + Intronic
1096741715 12:53698298-53698320 CTCCATCTCAAAAAAAAAGAAGG - Intergenic
1098803479 12:74991552-74991574 TACAATCTCAAAATTCAAGCTGG + Intergenic
1099616426 12:84941497-84941519 CTCAGTCTCAAAAAAAAAGAAGG + Intergenic
1101896327 12:108759768-108759790 TTCTATCTAAAAATAAAAAAAGG + Intergenic
1101933843 12:109039616-109039638 TTCCATCTCAAAAAAAAAAATGG - Intronic
1102127715 12:110498613-110498635 TGTAATCTCAAAGTAACACAAGG + Intronic
1103129936 12:118459414-118459436 CTCAATCTCAAAAGAAAAGCAGG - Intergenic
1103448125 12:121008139-121008161 TCCCATCTCAAAAAAAAAAAAGG - Intronic
1104027113 12:125035711-125035733 TGTAATCCCAAAATGAAAAATGG - Intergenic
1104395908 12:128432605-128432627 TGCAATCTCATGATAAAATTTGG + Intronic
1105032983 12:132897730-132897752 TACAATGTCTGAATAAAAGAAGG - Intronic
1105353920 13:19640541-19640563 TCCCATCTCAAAAAAAAAAAAGG - Intronic
1105395149 13:20025200-20025222 TACAATATGAAAATATAAGAAGG - Intronic
1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG + Intergenic
1106552633 13:30785211-30785233 TTCCATCTCAAAAAAAAATAGGG + Intergenic
1106691719 13:32124585-32124607 TGGAATCTGAAAAAAAAAGGTGG - Exonic
1107256334 13:38431953-38431975 GGCAATCTTAATATGAAAGAAGG + Intergenic
1107288919 13:38829644-38829666 TGAAATCTAAAAAAAAAAAAAGG - Intronic
1107632997 13:42361677-42361699 TGCAGCCTCCAAATAGAAGATGG + Intergenic
1108194815 13:47982630-47982652 TGCATTCTCAGAAAGAAAGAAGG - Intronic
1108872551 13:55004974-55004996 TGCAAGCTCAAAATCAAGTAGGG + Intergenic
1109005932 13:56876167-56876189 TGTATTCACAAAAGAAAAGATGG + Intergenic
1109425493 13:62161543-62161565 TGAGAACTCAAAATAAAAAATGG + Intergenic
1109916772 13:68998689-68998711 TGGGATGTCAAAATAAAACATGG - Intergenic
1110406368 13:75154922-75154944 TGCAAATCCAAAATAATAGATGG + Intergenic
1110580058 13:77111223-77111245 AGCATTCTCATAATTAAAGATGG - Intronic
1112026955 13:95419885-95419907 TCCCATCTCAAAAAAAAAAAAGG + Intergenic
1112323609 13:98428850-98428872 TGCCCTCTCAAAATCAAATAGGG + Intronic
1112573379 13:100613843-100613865 CGCCATCTCAAAAAAAAAGGGGG - Intronic
1112727789 13:102325110-102325132 AGAAACCTGAAAATAAAAGATGG + Intronic
1112908082 13:104448361-104448383 TGTAAACTCAAAATAAAACCTGG + Intergenic
1113011141 13:105767591-105767613 TGCATTCTTAAAGGAAAAGATGG - Intergenic
1113315061 13:109170533-109170555 TGCAATTTAAAAAAAAAAGGAGG + Intronic
1113427826 13:110224169-110224191 TGGAACTTCAAAAAAAAAGACGG - Intronic
1114241448 14:20871994-20872016 CTCAATCTCAAAAAAAAAGACGG + Intergenic
1114698669 14:24653335-24653357 TGAAATTTAAAAATAAAGGAAGG + Intergenic
1114906177 14:27129675-27129697 TGCAGTGTTAAAATAAAATAGGG + Intergenic
1115621794 14:35147933-35147955 TTCAATCACAAAATAAAACTTGG - Intronic
1115823975 14:37243967-37243989 TGCACTCACCAAAAAAAAGAAGG - Intronic
1116045403 14:39736744-39736766 TGCTATCTTAAAATAAAAGTTGG - Intergenic
1116124388 14:40764051-40764073 TGTAATCTAAATATAAAGGAAGG - Intergenic
1116205640 14:41862474-41862496 TGCAATCACGAAAAAAAAGAAGG - Intronic
1116974225 14:51097657-51097679 TCCAGTCTCAAAAAAAAAAAAGG - Intergenic
1117859144 14:60071647-60071669 TGTGATATCAAAATAAAATATGG - Intergenic
1117974780 14:61286768-61286790 CTCCATCTCAAAAAAAAAGAGGG + Intronic
1119117166 14:72034907-72034929 TGCAATCTGAAAATATTAAATGG + Intronic
1119251899 14:73163275-73163297 TGCAATCTAAAAGTACAAGATGG + Intronic
1120406052 14:84094591-84094613 CTCCATCTCAAAAAAAAAGAAGG - Intergenic
1121158577 14:91711685-91711707 TGCAATATCAGAAATAAAGAGGG + Intronic
1122731812 14:103805562-103805584 TGCTGTCTCAAAAAAAAGGAAGG + Intronic
1123500192 15:20874940-20874962 AGCCATCACAAAATAAAATAAGG + Intergenic
1123557439 15:21448634-21448656 AGCCATCACAAAATAAAATAAGG + Intergenic
1123593665 15:21885896-21885918 AGCCATCACAAAATAAAATAAGG + Intergenic
1124003987 15:25781646-25781668 TTCCGTCTCAAAAAAAAAGAAGG + Intronic
1124993544 15:34699635-34699657 CCCTATCTCAAAATAAAAAAAGG + Intergenic
1125350622 15:38763232-38763254 CGCCATCTCAAAAAAAAAAAAGG + Intergenic
1125498961 15:40225192-40225214 TGCAATAGAAAAATAAAGGAGGG - Intergenic
1125992605 15:44124345-44124367 AGTATCCTCAAAATAAAAGAAGG + Intronic
1126269938 15:46803537-46803559 TACAATCTAAAAGTAAATGAAGG + Intergenic
1127270707 15:57398962-57398984 TGCCAACTCAAAAGGAAAGAAGG - Intronic
1127571612 15:60248875-60248897 TTAAATCTCAAAATAAGAAAGGG - Intergenic
1128262708 15:66243504-66243526 GGCAATCTTAAAATATAACAAGG + Intronic
1128281619 15:66399451-66399473 TCCTATCTCAAAAAAAAAGAGGG - Intronic
1129104616 15:73297651-73297673 AACAATCTCAAAATATAAGAAGG - Intronic
1130290319 15:82593412-82593434 TGCAATCTCATGATAAAACTTGG - Intronic
1131761647 15:95629417-95629439 TGCAAAATCAAAATAAAAAATGG - Intergenic
1131865160 15:96700721-96700743 TGCACTCCCAAAATAAATGTAGG + Intergenic
1202965787 15_KI270727v1_random:175807-175829 AGCCATCACAAAATAAAATAAGG + Intergenic
1133392426 16:5421011-5421033 TCCAGTCTCAAAAAAGAAGAAGG - Intergenic
1133438921 16:5804414-5804436 TGAAATATCAAAAGAAAACAAGG + Intergenic
1133766070 16:8838686-8838708 TCCAAGGTCCAAATAAAAGAAGG + Intronic
1134268884 16:12716517-12716539 TGGAATCTTAAAGTAAAAAAAGG - Intronic
1134332962 16:13267053-13267075 TAAAATCACAAAATAAAAGATGG + Intergenic
1135006742 16:18830785-18830807 CTCCATCTCAAAAAAAAAGAAGG + Intronic
1136129009 16:28207239-28207261 TGCCATCTCAAAAAAAAAAAAGG + Intronic
1138758340 16:59515705-59515727 TACAAGGTCCAAATAAAAGAAGG + Intergenic
1138853728 16:60661636-60661658 TTAAACCTCAAAATAACAGAAGG - Intergenic
1139300087 16:65937687-65937709 TTCAGTCTCAAAAAAAAAAAAGG - Intergenic
1140644711 16:77016921-77016943 TGCAATCACAAAAAAAAATTTGG + Intergenic
1140689912 16:77472036-77472058 TGGAATCTCAAGAAAAAAAATGG + Intergenic
1141536968 16:84688541-84688563 TGCCATCTCAAAAAAAAGAAAGG - Intergenic
1142333137 16:89468698-89468720 CGCTATCTCAAAAAAAAAGAAGG + Intronic
1142981225 17:3673173-3673195 CTCCATCTCAAAAAAAAAGATGG + Intronic
1146207463 17:30917334-30917356 TGCAATCCCAGAATAAATGGTGG + Intronic
1147454673 17:40529781-40529803 CCCAATCTCAAAAAAAAAGGGGG - Intergenic
1148497668 17:48063070-48063092 TTCCATCTCAAAAAAAAAAAAGG + Intergenic
1149933587 17:60780973-60780995 CTCCATCTCAAAAAAAAAGATGG - Intronic
1150054135 17:61996138-61996160 TGAAATCTAAGGATAAAAGAGGG + Intronic
1150298884 17:64031819-64031841 TGACATCTCAAAATAAATGGGGG + Intergenic
1150332415 17:64304947-64304969 CTCAGTCTCAAAAAAAAAGAAGG - Intergenic
1150860517 17:68796268-68796290 TACAAGGTCCAAATAAAAGAAGG + Intergenic
1151110142 17:71666744-71666766 TGCAATCTTAAAAAAAAAAATGG + Intergenic
1151206300 17:72510238-72510260 AGGAGTCTCAAAATAAAATATGG - Intergenic
1151594284 17:75067556-75067578 TTAAATCTAAAAATAAAATAAGG + Intergenic
1151867798 17:76815946-76815968 CTCCATCTCAAAAAAAAAGAAGG + Intergenic
1152790538 17:82276412-82276434 GGCAATTTTAAAAGAAAAGAGGG - Intergenic
1153691504 18:7599280-7599302 TTCAAGCTTAAAATAAAAAATGG + Intronic
1155737981 18:29248000-29248022 TGCATGCTGAAAATAAAACATGG - Intergenic
1155795723 18:30034585-30034607 TGCAAACTTAACATAAAACAGGG - Intergenic
1155871623 18:31036797-31036819 TTCCATCTCAAAAAAAAAAAAGG - Intronic
1156025813 18:32653953-32653975 TTCAATATCAAAGTACAAGAAGG - Intergenic
1156728440 18:40159465-40159487 TACAATCTCAATAGAAAAAAAGG + Intergenic
1156763465 18:40621878-40621900 TGCAATCTCAGATAAAGAGAAGG - Intergenic
1157345696 18:46829973-46829995 TGCAATACCAAAAGAAAAGGGGG - Intronic
1157878814 18:51299067-51299089 TCCCATCTCAAAAAAAAAAAAGG - Intergenic
1158164011 18:54518628-54518650 TTCAAGGTCAAAATTAAAGAAGG + Intergenic
1158253355 18:55515851-55515873 TCCTATCTTAAAATTAAAGATGG - Intronic
1158649222 18:59272109-59272131 TCTAAACTCAAAATAGAAGATGG - Intronic
1158674727 18:59507896-59507918 TGCCATCTCAAAAAAAAAAAAGG - Intronic
1159015722 18:63100396-63100418 TGAAAACTAAAAATAAGAGATGG - Intergenic
1160129220 18:76209401-76209423 TGACATCACAAAAGAAAAGAAGG + Intergenic
1161023309 19:2022110-2022132 GTCCATCTCAAAACAAAAGAAGG - Intronic
1161603742 19:5202688-5202710 TCCTACCTCAAAATAAAAAAAGG + Intronic
1161828294 19:6584497-6584519 CTCCATCTCAAAAAAAAAGATGG + Intronic
1162227979 19:9240172-9240194 TACAATTGCAAAATTAAAGAGGG - Intergenic
1162842661 19:13367719-13367741 TTCCATCTCAAAAAGAAAGAAGG + Intronic
1163840358 19:19604458-19604480 TTCCATCTCAAAAAAAAAAAAGG + Intronic
1165967196 19:39592412-39592434 CTCGATCTCAAAATAAAAGTAGG + Intergenic
1166229167 19:41415653-41415675 TTCCATCTCAAAAAAAAAAAAGG - Intronic
1166502369 19:43351575-43351597 CTCCATCTCAAAAAAAAAGACGG - Intergenic
1166727204 19:45036079-45036101 GACTATCTCAAAAAAAAAGAGGG - Intronic
925837688 2:7961998-7962020 TACAATCTAAGAATAAAAGCAGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926904551 2:17793767-17793789 TGCTATGTTAAAGTAAAAGAAGG + Intronic
927020544 2:19012347-19012369 TACAATCTTGAAACAAAAGAAGG - Intergenic
927903845 2:26843405-26843427 TGAAATTTAAAAATAAAAGCAGG + Intergenic
928019679 2:27693668-27693690 TGGAAGCTAAAAAGAAAAGATGG - Exonic
928529481 2:32176649-32176671 TTCCATCTCAAAAAAAAAAAAGG + Intronic
928796675 2:35031654-35031676 TGCAGTGTAAATATAAAAGAAGG + Intergenic
928813864 2:35264859-35264881 TTGAATCTCAAAATAAGAGGAGG - Intergenic
928821216 2:35364301-35364323 TTCTCTCTCAAAATAAAACAAGG + Intergenic
929259020 2:39844259-39844281 TCCCCTCTCAGAATAAAAGATGG - Intergenic
929320441 2:40537532-40537554 TATAATCTCAAAATATTAGAAGG - Intronic
929323308 2:40573207-40573229 TGCAATCTCATGATAAAACTTGG + Intronic
929676651 2:43939444-43939466 TGCAATCACTACAGAAAAGAAGG + Intronic
930191598 2:48465771-48465793 TTTACTCTCAAAATAAAATATGG + Intronic
930444604 2:51454112-51454134 TGTAATCTTGCAATAAAAGAAGG + Intergenic
931550958 2:63445689-63445711 AGGCATCTCAAAATAAAACAAGG + Intronic
932665018 2:73690283-73690305 CCCCATCTCAAAAGAAAAGAAGG + Intergenic
932989776 2:76772432-76772454 AGCAATGTCTAAATAAAAGTTGG + Intronic
933228803 2:79782223-79782245 TAAAATATAAAAATAAAAGAAGG - Intronic
933360234 2:81272406-81272428 TGAAATCTCCAAACAAAAGATGG + Intergenic
933610756 2:84432288-84432310 TGTAATTTAAAAATAAAAAACGG - Intronic
933936993 2:87214339-87214361 TGCTTTCTTAAAATAAGAGAGGG - Intergenic
934015828 2:87880988-87881010 TGCAAGTTCAAAATCAAACAGGG + Intergenic
934908082 2:98223110-98223132 GGCAATCTCAGAATATAAGTAGG + Intronic
935043824 2:99461149-99461171 TGTCATCTCAAAATAAATGCTGG - Intronic
935293051 2:101625996-101626018 CTCCATCTCAAAAAAAAAGAAGG - Intergenic
935439118 2:103071044-103071066 TGAAATTTCAAAATTAAAAAGGG + Intergenic
936356149 2:111751485-111751507 TGCTTTCTTAAAATAAGAGAGGG + Intergenic
937054050 2:118916215-118916237 CTCCATCTCAAAAAAAAAGAGGG - Intergenic
937502624 2:122497380-122497402 TGCAATAAGAAAATAACAGAAGG - Intergenic
937515952 2:122655569-122655591 TGCCATCTCAAAAAAAAAAAAGG + Intergenic
937612298 2:123876580-123876602 TTCAAACACAAAATGAAAGAAGG - Intergenic
939361090 2:141173960-141173982 TGCTATCTAAAATAAAAAGAAGG - Intronic
939436776 2:142187035-142187057 TGAAATCTTAAAAAAAAAGAGGG - Intergenic
939532155 2:143376881-143376903 TGCAATCTAAAAAGCAAAAAAGG - Intronic
939532692 2:143384410-143384432 TAGAATATAAAAATAAAAGAAGG - Intronic
939911491 2:147988820-147988842 TGGAATTTTAAAATAAAAGTAGG + Intronic
939967558 2:148625352-148625374 TTCTGTCTCAAAATAAAAAAGGG + Intergenic
940530793 2:154873800-154873822 TACAAGGTCCAAATAAAAGAAGG - Intergenic
941455393 2:165708318-165708340 TACAAGGTCCAAATAAAAGAAGG + Intergenic
942286019 2:174416875-174416897 TCCAATCTCAGTATAAAAAAAGG + Intronic
942447366 2:176086844-176086866 TGGAATCTCTAAATAAATTAAGG - Intergenic
942899431 2:181096308-181096330 TTCCATCTCAAAAAAAAAAAAGG - Intergenic
943061987 2:183048965-183048987 TACAAGGTCTAAATAAAAGAAGG - Intergenic
943112882 2:183627855-183627877 TGCAATCTTCAAATACAAGCAGG - Intergenic
943725418 2:191246556-191246578 TCAAATCTCAAAAAAAAAGGGGG - Intronic
943809618 2:192168351-192168373 TTCAATGTCAAATTAAATGAAGG + Intronic
944010733 2:194971660-194971682 TGCAATCTGAAGATAAAACTTGG + Intergenic
944556045 2:200888814-200888836 TGCAACGTCAGAGTAAAAGAAGG - Intronic
944920645 2:204409413-204409435 TGCAGGGTCAAAATAAAGGAGGG + Intergenic
945343661 2:208687141-208687163 CCCAATCTTAAAATAAAAGTTGG - Intronic
945447256 2:209953115-209953137 GGGAATCTCTAAACAAAAGATGG + Intronic
945793625 2:214334719-214334741 AGCAATCTGGAAATGAAAGAAGG - Intronic
946231552 2:218294497-218294519 TTCCATCTCAAAAAAAAGGAAGG - Intronic
946612842 2:221478002-221478024 TGCAAAGTAAAAATAAAAAATGG + Intronic
946969500 2:225075990-225076012 TGAATTCCCAAAATAAAATATGG - Intergenic
948225197 2:236304413-236304435 CTCCATCTCAAAATAAAATAAGG - Intergenic
948497324 2:238360200-238360222 TGCAATCTGAAAATATTAAATGG - Intronic
1168775140 20:441081-441103 CTCCATCTCAAAAAAAAAGAAGG + Intronic
1169526479 20:6432165-6432187 GGCAATCACAAAATAAAAAAAGG - Intergenic
1170290681 20:14765083-14765105 TGTATTCTCAAATTTAAAGAGGG - Intronic
1171106386 20:22437203-22437225 TGCCAACTAAAAATAAAAGAGGG - Intergenic
1173215078 20:41073651-41073673 TGCAATGTTAAAAGAAAAGCTGG - Intronic
1173816194 20:45990098-45990120 CATAATCACAAAATAAAAGAAGG - Intergenic
1174193770 20:48758429-48758451 TGCAGCCTCAAAAAGAAAGAGGG + Intronic
1174195748 20:48771629-48771651 CTCCATCTCAAAATAAAAAAAGG + Intronic
1174409582 20:50325572-50325594 TGAAAGTTCAAAATAAAATAAGG - Intergenic
1174708497 20:52681388-52681410 GACCATCTGAAAATAAAAGAAGG - Intergenic
1175050213 20:56148441-56148463 TGCAATTTCAAAATAAAGGGTGG + Intergenic
1175235102 20:57504283-57504305 TCCCATCTCAAAAAAAAAAAAGG - Intronic
1177051241 21:16237695-16237717 TGCAGTCTTAAAAAAAAAAAAGG + Intergenic
1177469541 21:21540520-21540542 AAAAATTTCAAAATAAAAGATGG + Exonic
1177852505 21:26365367-26365389 CGCTGTCTCAAAAAAAAAGAAGG - Intergenic
1178070788 21:28963973-28963995 TGCAATATCATAATAAAATGTGG + Intronic
1178220550 21:30653092-30653114 TGAAATCTCAAAATAATTTATGG - Intergenic
1178750097 21:35294613-35294635 TGCAATCTGAAAGTGAGAGAAGG - Intronic
1179114984 21:38482682-38482704 TTCCATCTCAAAAAAAAAAAAGG - Intronic
1179227116 21:39464226-39464248 CTCCATCTCAAAAAAAAAGAGGG - Intronic
1179277631 21:39906638-39906660 CTCAATCTCAAAAAGAAAGAAGG - Intronic
1180667206 22:17523370-17523392 TTCCATCTCAAAAAAAAAAAAGG + Intronic
1180754771 22:18153421-18153443 TTCCATCTCAAAAAAAAAAAAGG + Intronic
1180947027 22:19701051-19701073 TGCCATCTCAAAAAAAAAAAAGG + Intergenic
1181760375 22:25054242-25054264 CTCCATCTCAAAAAAAAAGAAGG + Intronic
1182258595 22:29056105-29056127 TTCCATCTCAAAAAAAAAAAAGG - Exonic
1183774232 22:39952655-39952677 AGCAATCTCAAACTCAAATATGG + Intronic
1184050426 22:41999758-41999780 TCCTGTCTTAAAATAAAAGATGG + Intronic
1184316500 22:43697044-43697066 TGCAACCTCAATATAAATCAAGG + Intronic
950236972 3:11330934-11330956 TGCAATGAGAAAATCAAAGAAGG - Intronic
950315804 3:12001251-12001273 TGCAATCTAAAAAGAGAAGCTGG + Intergenic
951401467 3:22237648-22237670 CCCCATCTCAAAATAAAATAAGG - Intronic
951422107 3:22498985-22499007 TGCGATCTCAAATATAAAGAAGG + Intergenic
951497997 3:23351510-23351532 CACAGGCTCAAAATAAAAGATGG + Intronic
951695819 3:25444741-25444763 CTGCATCTCAAAATAAAAGAGGG + Intronic
951992498 3:28691324-28691346 AGCATTCCCAAAATAAAAAATGG + Intergenic
952125525 3:30295596-30295618 TGCAATTTGAAAATACAATATGG - Intergenic
952305722 3:32144469-32144491 TGGAATCACAAACTAAAATAAGG + Intronic
952647730 3:35681930-35681952 AGTATTCTGAAAATAAAAGAAGG - Intronic
952740001 3:36725608-36725630 CCCTGTCTCAAAATAAAAGAGGG + Intronic
955000890 3:54926959-54926981 TCAAGTCTCAAAAAAAAAGAAGG - Intronic
955928091 3:64027687-64027709 TGCGATCTCGAAATAAAACCAGG - Intergenic
956367148 3:68516779-68516801 CTCCATCTCAAAAAAAAAGAAGG - Intronic
957263183 3:77926636-77926658 TGCAATCACAGAATAAACTATGG - Intergenic
957581619 3:82080252-82080274 TAAAATCTCAAAATAAAATCTGG - Intergenic
958075840 3:88677062-88677084 TGCAATGTGAAGATAACAGACGG + Intergenic
958788135 3:98621479-98621501 TGGCATCTGAAAATCAAAGAAGG - Intergenic
958888801 3:99760152-99760174 GACATTCTCAAAATAAAACAAGG - Intronic
959749819 3:109820242-109820264 TGCATGTTCAAAATAGAAGAGGG + Intergenic
960001929 3:112741514-112741536 GGAAATCTCAAAATAACAAAAGG - Intergenic
961108780 3:124265617-124265639 TGAAATCTCAACAAACAAGAAGG + Intronic
961202886 3:125058233-125058255 TCCAATCTCTAAAACAAAGATGG + Intergenic
962312310 3:134335279-134335301 TGCAATCGGAAAATCAAAAAAGG + Intergenic
962827533 3:139110936-139110958 TCCTATCTCAAAAAAAAAAAAGG - Intronic
963552805 3:146745639-146745661 CTCCATCTCAAAAAAAAAGAAGG + Intergenic
963749711 3:149163963-149163985 TGCAATTTCATAAGAAAAGGAGG - Intronic
964000784 3:151769540-151769562 TGAAATCTCATATTAAAGGAGGG + Intergenic
964395788 3:156244262-156244284 TGCACTTTGAAGATAAAAGAAGG - Intronic
964794900 3:160486063-160486085 TCAAATGTCAGAATAAAAGAGGG - Intergenic
965261902 3:166497741-166497763 TGAAATCTCCAAAATAAAGAAGG + Intergenic
965539596 3:169858998-169859020 CGCCATCTCAAAAAAAAAAAGGG + Intronic
965549004 3:169945383-169945405 TGAAAGCACAAAATAACAGAAGG + Intergenic
965896138 3:173578723-173578745 TGCAATGTCAAAATCAATCATGG + Intronic
966096110 3:176205156-176205178 TGCAATCTCATGATAAAACTTGG + Intergenic
967242882 3:187458303-187458325 TGCATTTTCAAAGTCAAAGAGGG + Intergenic
970270142 4:14337862-14337884 GAGAATCTCAAAATAAAGGAAGG + Intergenic
970393207 4:15637148-15637170 TGAAATGTGAAAATCAAAGAGGG - Intronic
970589999 4:17551484-17551506 TGCAGTTTAAAAATAAAAAAAGG + Intergenic
971159442 4:24118921-24118943 TGCAATCTAAAAATAACAAAAGG + Intergenic
971942985 4:33239497-33239519 TACAGGCTCAAAATAAAGGATGG - Intergenic
972015268 4:34235481-34235503 TGAAATCTCACAATAAAGGTAGG + Intergenic
972366917 4:38384474-38384496 TGCCTTCTCACAATACAAGAAGG + Intergenic
972411637 4:38801286-38801308 TGCCATATGAAAATACAAGAAGG + Intronic
972579987 4:40386637-40386659 CTCCATCTCAAAATAAAAAAAGG - Intergenic
973165032 4:47066639-47066661 TGCAATCTCATGATAAAACTTGG - Intronic
973552971 4:52053400-52053422 TGCAAACTCAAGAGAAATGATGG - Intronic
973554648 4:52070807-52070829 AGCAATCTCATAAAAAAATAAGG + Intronic
975065082 4:70051525-70051547 TGCAAGTACAAAATAAAAAAGGG - Intronic
975527632 4:75368188-75368210 TCCAACCTCAGAATCAAAGAGGG - Intergenic
976262339 4:83157744-83157766 CTCCATCTCAAAAAAAAAGAAGG - Intergenic
976469452 4:85410939-85410961 TTCAGTCTCATAATCAAAGATGG - Intergenic
976530425 4:86145882-86145904 TGCAACCTCAAAGGTAAAGAAGG - Intronic
977208542 4:94191532-94191554 TTCTATCTCAAAAAAAAAAAAGG + Intergenic
977263434 4:94825541-94825563 TCCCATCTTAAAAAAAAAGATGG - Intronic
977276593 4:94984903-94984925 TGCAGATTCAAATTAAAAGAAGG - Intronic
977315586 4:95443642-95443664 CACAAACTGAAAATAAAAGATGG - Intronic
977407718 4:96621048-96621070 TGAAATGTCAAAATAAAAAAAGG - Intergenic
977480852 4:97573439-97573461 TGAAATCTGAAGAGAAAAGAAGG + Intronic
977736902 4:100427658-100427680 TGAAATCTCCAAATAAATGAGGG - Intronic
977998402 4:103525111-103525133 TGCAATCACTAAACAAAGGATGG - Intergenic
978117376 4:105036792-105036814 TGCACTCTCTAATTAAAAGACGG + Intergenic
978204261 4:106060990-106061012 TGCAATCTCATGATAAAACTTGG + Intronic
978352019 4:107829897-107829919 TGCACACCCAAAATAAAAGCTGG - Intronic
978962039 4:114692022-114692044 TGAAATATCAAAATAGGAGAGGG - Intergenic
978966974 4:114752022-114752044 TACAATCTCTAAATAAATTAAGG + Intergenic
979102739 4:116642724-116642746 TACAATATCAATATAAAATAAGG + Intergenic
979244938 4:118491601-118491623 TGCAATCTGAAAAGAAAAAATGG - Intergenic
980310613 4:131125332-131125354 TGCAAGTTCAAAATCCAAGAGGG + Intergenic
981163991 4:141535491-141535513 TGCAATCTCACGATAAAACTTGG - Intergenic
981701748 4:147615068-147615090 GACAATTTCAAAATAAAACATGG + Intergenic
981730223 4:147889303-147889325 CTCCATCTCAAAAAAAAAGAAGG - Intronic
981819628 4:148870873-148870895 TGCAATTCTAAAATAAAGGAAGG + Intergenic
982057324 4:151565074-151565096 TGTAATGTCAAAAGAAAACAGGG - Intronic
983086355 4:163449898-163449920 TGTAATCTCATAATAAAACTTGG - Intergenic
983442592 4:167806054-167806076 TGAAATTTCAAAAGAAAAAAAGG - Intergenic
984126020 4:175811887-175811909 TGAAATCACGAAATAAATGAAGG + Intronic
984303148 4:177950184-177950206 TGCAATGTAAAAAAAAAAAAAGG - Intronic
984354660 4:178642293-178642315 TTCCATCTCAAAAAAAAAAAAGG - Intergenic
984580362 4:181503446-181503468 TGCAATCTACAAATAAAAATGGG - Intergenic
985103385 4:186479555-186479577 CTCCATCTCAAAAAAAAAGATGG - Intronic
986350191 5:6870469-6870491 TGCAATCTCAAGCAAAATGATGG + Intergenic
986536257 5:8790838-8790860 TGAAATATCTAAACAAAAGAAGG + Intergenic
986699985 5:10397153-10397175 TGAAATCCCAAAACAATAGAGGG + Intronic
986752173 5:10797106-10797128 TGCAATGTCAAGATAAAACCTGG + Intergenic
987375421 5:17229686-17229708 TGCCATAACAAAATAACAGATGG + Intronic
987904283 5:24055434-24055456 TCCAATGTCAAAACAAAAAAAGG + Intronic
988357120 5:30192396-30192418 TTCAATCTCAGAATAGAAAAAGG - Intergenic
988501162 5:31784898-31784920 TGCCGTCTCAAAAAAAAAAAAGG + Intronic
988611631 5:32732279-32732301 TCCATTCTCAAGATCAAAGATGG + Intronic
989038056 5:37196170-37196192 TGTTATCTCAAAAAAAAAAAAGG + Intronic
989192876 5:38688507-38688529 TGCCATCTCAGAAAAAAAAATGG - Intergenic
989345633 5:40426379-40426401 TGCAGTCACAAAAAAAAGGAAGG + Intergenic
990939829 5:61190580-61190602 TTCAATCTAAAAGGAAAAGATGG + Intergenic
991338688 5:65580518-65580540 TGCCATCTCCAAAAAACAGAGGG - Intronic
991490841 5:67181308-67181330 TGAAATCTCAAGATGAAGGAAGG + Intergenic
992285669 5:75233066-75233088 TCCCATCTCAAAAAAAAAAAAGG - Intronic
992469268 5:77040612-77040634 TGCAATGTTAAATTGAAAGAAGG + Intronic
993032913 5:82725734-82725756 TGCAGTCTCTAAATAAAACATGG - Intergenic
993167815 5:84381075-84381097 TGCAACTTCAAGATCAAAGAAGG + Intronic
993214778 5:85006060-85006082 AGCAAGCTCAAAGTAAAAGTAGG - Intergenic
993421642 5:87709283-87709305 AGCATTCTCAAAGTTAAAGAAGG - Intergenic
993740046 5:91527864-91527886 TGCTGTCTCAAAAAAAAAAAAGG - Intergenic
993846528 5:92951394-92951416 TGCAAGCACAAAACAAAAGGGGG - Intergenic
993988804 5:94630623-94630645 TGCAATCTGCACCTAAAAGATGG + Exonic
994366694 5:98925701-98925723 TCCAATCTGAAAATAAAAAAGGG + Intronic
994936624 5:106261334-106261356 TACTATCTCAAAATATAAGCTGG - Intergenic
995073669 5:107955441-107955463 TGCAAAATCAACATTAAAGAGGG - Intronic
995118871 5:108514902-108514924 TGCAATATTTAAATAAAAAATGG - Intergenic
995904790 5:117110576-117110598 AGCAATCTCAAAGTAAGAAAAGG - Intergenic
995941186 5:117586611-117586633 TGTAGTCTGAAGATAAAAGACGG - Intergenic
995984170 5:118148159-118148181 TGCAAACTGAAAAAAAAATAGGG - Intergenic
996267955 5:121565021-121565043 CTCCATCTCAAAATAAAAAAAGG + Intergenic
997125303 5:131220650-131220672 TGCGATCACAAAATAAATCAAGG + Intergenic
997201940 5:132015703-132015725 TGCACTCTCCAAAAAAAAAAAGG - Intergenic
997334360 5:133094951-133094973 AGTAATCTCAAAGGAAAAGATGG + Intronic
998014920 5:138724412-138724434 CTCTATCTCAAAAAAAAAGAAGG + Intronic
998227800 5:140340277-140340299 TTCCATCTCAAAAAAAAAAAAGG + Intronic
998736412 5:145146213-145146235 TGCACTCTCTAAAAGAAAGATGG + Intergenic
999346261 5:150822354-150822376 TGCAATCTGAAAATAATAAATGG - Intergenic
999934463 5:156470962-156470984 TTCAACATCAAAAAAAAAGAAGG - Intronic
1000000593 5:157135087-157135109 TGCAAACTTAAAAAAAATGAGGG - Intronic
1001491689 5:172160466-172160488 TGCCATCTCAAAAAAAAAAAAGG + Intronic
1003480023 6:6522698-6522720 TTAATTCTTAAAATAAAAGAAGG + Intergenic
1004515070 6:16315667-16315689 CCCTATCTCAAAATAAAAAAAGG - Intronic
1004586359 6:17005357-17005379 TTCTGTCTCAAAAAAAAAGAAGG - Intergenic
1005129255 6:22485780-22485802 TGCATTCCCAAAATCAATGAAGG - Intergenic
1005213884 6:23502139-23502161 TGCAGTCTCAAGATAATAGAGGG - Intergenic
1006632971 6:35442550-35442572 CTCCATCTCAAAATAAAAAAAGG - Intergenic
1006686865 6:35842629-35842651 TGAAAGCACAAAAGAAAAGAAGG + Intronic
1008103983 6:47423201-47423223 TCCAGTCACTAAATAAAAGAAGG - Intergenic
1008119872 6:47600454-47600476 TGCATTCGCAAACTGAAAGAGGG - Intronic
1008262026 6:49378421-49378443 TGGCATCTCAAAAGAAAAAAAGG + Intergenic
1008270970 6:49489348-49489370 TGCAATCTCATGATAAAAATTGG - Intronic
1009062377 6:58413206-58413228 ATCAATTTCAAAATCAAAGAAGG - Intergenic
1009268494 6:61588345-61588367 TGCAACCTCAAAAGAGGAGAAGG - Intergenic
1009343966 6:62591018-62591040 TACAAGGTCCAAATAAAAGAAGG - Intergenic
1009502528 6:64433259-64433281 AACAATAACAAAATAAAAGAGGG + Intronic
1009848617 6:69166178-69166200 TGCAATCTCAATACAGAAGAGGG + Intronic
1010801972 6:80186797-80186819 TGAAATATCAAAGTAGAAGAAGG - Intronic
1010825055 6:80463046-80463068 TGCAATTTAAACAAAAAAGAAGG + Intergenic
1010834200 6:80566750-80566772 TGCAGTCTCAAAACATAAAATGG - Intergenic
1010911597 6:81564749-81564771 TGAAATGACAAAATTAAAGAGGG - Intronic
1011119073 6:83930511-83930533 TGCAATCTCATGATAAAACTTGG - Intronic
1011673752 6:89710519-89710541 AGAAATTTCAAAAAAAAAGAAGG + Intronic
1011808337 6:91099077-91099099 GGGATTCTCAAAATAAACGAGGG - Intergenic
1012072115 6:94635852-94635874 TGCTATTTCATAATACAAGAAGG - Intergenic
1012402069 6:98848933-98848955 AGCAATCTCAAAAACAAAAAAGG + Intergenic
1012717018 6:102687618-102687640 TTCATTCTCAGAATAATAGAGGG - Intergenic
1012835611 6:104262551-104262573 TGCAGTGTGCAAATAAAAGATGG - Intergenic
1013870820 6:114757638-114757660 GAGATTCTCAAAATAAAAGAAGG + Intergenic
1014633384 6:123814770-123814792 TGAAATATTAAATTAAAAGATGG - Intronic
1015098149 6:129441974-129441996 TGCTGTCTCAAAAAAAAAAAAGG + Intronic
1015455439 6:133422054-133422076 TGCAATATCATAATAAGAAATGG - Intronic
1015876038 6:137823684-137823706 TGACATCCCAAAATAAATGAAGG - Intergenic
1015891015 6:137969836-137969858 TCCCATCTCAAAAAAAAAGTGGG + Intergenic
1016587077 6:145701097-145701119 TATAAACTGAAAATAAAAGAGGG + Intronic
1016830512 6:148429215-148429237 TGCAAACACAAATTAAAGGAAGG + Intronic
1016938428 6:149465746-149465768 CGCCATCTCAAAAAAAAAAAAGG + Intronic
1017264756 6:152430223-152430245 TGCAATATAAAAATAACAGTGGG + Intronic
1017554238 6:155545803-155545825 TGTAATTTCAAAAGAGAAGAAGG - Intergenic
1019203418 6:170339441-170339463 TTCAATTTAAAAAAAAAAGAGGG + Intronic
1020266104 7:6561108-6561130 TGCCGTCTCAAAAAAAAAGAGGG + Intergenic
1020387668 7:7625719-7625741 TGCAATCTCAAAATCGAAAATGG - Intergenic
1020517289 7:9139009-9139031 TGCAATTTAAAAATAAAATCTGG + Intergenic
1021262269 7:18472754-18472776 TGCAACATTAAAATAAAACAGGG - Intronic
1021562658 7:21984547-21984569 TGTAATCTAAAAATACAACAGGG + Intergenic
1021682673 7:23150181-23150203 ATCAATCTAAAAATAAAATAAGG - Intronic
1021684093 7:23164915-23164937 TCCTATCTCAAAAAAAGAGAGGG + Intronic
1021728498 7:23573509-23573531 AGCTATCTCAAAATAAATAAAGG - Intergenic
1022551583 7:31245036-31245058 TGCAATATGAAAATAAACCAAGG - Intergenic
1024045613 7:45583644-45583666 CTCCATCTCAAAAAAAAAGAAGG - Intronic
1024240708 7:47433296-47433318 AGCAATTTCAAATTAAAAGAGGG + Intronic
1025616840 7:63126960-63126982 TGCAATTAGAAACTAAAAGAGGG + Intergenic
1025703028 7:63837432-63837454 TGCAATACTAAAATAAAAAATGG + Intergenic
1026235579 7:68524063-68524085 TGCAATATCAGGATGAAAGAAGG + Intergenic
1027741545 7:82013645-82013667 TGAAATATCAAAATTAAGGATGG + Intronic
1027898064 7:84070815-84070837 TTTAATCTCAAAGGAAAAGAAGG - Intronic
1028178348 7:87684282-87684304 TGCAATCTCAAAGTTTTAGAAGG + Intronic
1028308245 7:89293857-89293879 TGTGATCTCAAAATAAGAGGTGG - Intronic
1028498894 7:91496110-91496132 TGTAATTTTGAAATAAAAGAAGG - Intergenic
1028684865 7:93580622-93580644 TGCAATATCCAAAGAAAAGTTGG - Intergenic
1029080312 7:97968400-97968422 TTCCATCTCAAAAAAAAAAAAGG - Intergenic
1029778375 7:102703618-102703640 TATAATCTCATTATAAAAGACGG + Intergenic
1030564443 7:111135894-111135916 TCTTATCTCAGAATAAAAGATGG + Intronic
1030652509 7:112130683-112130705 TACACTCTCAAAATAAACGTAGG + Intronic
1030655738 7:112165662-112165684 TTAAATATCAAGATAAAAGAAGG - Intronic
1032301682 7:130693237-130693259 TTCCATCTCAAAAAAAAAAAAGG + Intergenic
1032534542 7:132651260-132651282 TACAAACTCAAAATCAAAAAGGG + Intronic
1032684411 7:134217668-134217690 TGCTATCTCAAAACTAAAGGTGG - Intronic
1033768563 7:144522764-144522786 AGCAATCTAAAAATACAATAGGG - Intronic
1033998976 7:147388115-147388137 TTGAATATCAAAATAAAAAAGGG - Intronic
1034735645 7:153426889-153426911 TGCCCTGTCAAAATAAAAAAGGG - Intergenic
1035319251 7:158017876-158017898 TGCAATGCAAAATTAAAAGAAGG - Intronic
1035846454 8:2870648-2870670 AGCAATCTCAAGATGAAAAATGG + Intergenic
1036760343 8:11504314-11504336 TTCCATCTCAAAATAAAGAAAGG + Intronic
1037248065 8:16859813-16859835 TTCTATCTCAAAATAATAGATGG + Intergenic
1037524128 8:19708180-19708202 TAGAATGTCAAAATAAAACAGGG - Intronic
1037744995 8:21636152-21636174 TGCAATCACAAATGAAAAGAAGG + Intergenic
1038753113 8:30315262-30315284 CTCCATCTCAAAAAAAAAGAAGG + Intergenic
1038856472 8:31338388-31338410 CTCAGTCTCAAAATAAAAAAAGG + Intergenic
1039156424 8:34563918-34563940 TGCAATCTTAAAAAAATAGTAGG + Intergenic
1039698934 8:39942930-39942952 TTCAATCTCAAATGAAAAGATGG - Intronic
1041778637 8:61553280-61553302 TGCAATGCCAAAACAAAAGGAGG + Intronic
1042007214 8:64194466-64194488 CTCCATCTCAAAAAAAAAGAAGG - Intergenic
1042460275 8:69057769-69057791 TGGAATCCTAAAATATAAGAGGG - Intergenic
1042896240 8:73671630-73671652 AGCAATCTTAACAAAAAAGAGGG + Intronic
1043101734 8:76055973-76055995 TGCAATATAAATATTAAAGAAGG + Intergenic
1043239236 8:77911262-77911284 TGCAAACTAAACATAAAATAAGG + Intergenic
1043245102 8:77989505-77989527 TGCAATGTCTAAATAAAATAAGG - Intergenic
1043753145 8:83966718-83966740 CACAAACTCAGAATAAAAGAAGG - Intergenic
1044001879 8:86893060-86893082 GGAAACCTCAAAATAAAAAATGG - Intronic
1044006330 8:86941626-86941648 TGCAATGTCAAAATACCAGGAGG + Intronic
1046008112 8:108510298-108510320 TGAAATCACAAAATAAAATTTGG + Intergenic
1046321463 8:112582401-112582423 AGCAATGTAAAAAAAAAAGAGGG + Intronic
1046353528 8:113047313-113047335 TGCAACCTCAAAATATAGAACGG + Intronic
1046373162 8:113338278-113338300 AGAAATCTCAAAATGTAAGATGG + Intronic
1046686218 8:117230161-117230183 TGCAATGCCAGAAGAAAAGATGG - Intergenic
1046864327 8:119129195-119129217 TGCCATCTCAAAAAAAAACGGGG + Intergenic
1047049497 8:121095077-121095099 CTAAATGTCAAAATAAAAGATGG + Intergenic
1047365454 8:124207078-124207100 TGCAATCTGAAAATATTAAATGG - Intergenic
1048684149 8:136883278-136883300 TCCAAATTTAAAATAAAAGATGG - Intergenic
1049292092 8:141809370-141809392 TTCCATCTCAAAAAAAAAGATGG + Intergenic
1049977314 9:872066-872088 TGCCATCACAAAAAAAAAGATGG - Intronic
1050164601 9:2751078-2751100 TGGAATTTTAAAACAAAAGATGG - Intronic
1050295884 9:4204905-4204927 CTCCATCTCAAAAAAAAAGAAGG + Intronic
1050662322 9:7895975-7895997 TGCAAACACATAAGAAAAGAGGG - Intergenic
1050669345 9:7978783-7978805 CTCAGTCTCAAAAAAAAAGAAGG - Intergenic
1050848754 9:10257957-10257979 TGCAAAAACAAAATAAAGGAAGG + Intronic
1051879852 9:21828667-21828689 CTCCATCTCAAAAAAAAAGAAGG + Intronic
1052499111 9:29266408-29266430 TGCAATCTCATAATAAAACTTGG + Intergenic
1052695708 9:31874731-31874753 TGCATTCGCAAAATACTAGAAGG - Intergenic
1052740756 9:32390491-32390513 TGCAGTCTTCAAATAAGAGAAGG + Intronic
1054829574 9:69608589-69608611 TGCTACTTCAACATAAAAGAGGG + Intronic
1056222084 9:84459937-84459959 CATAATCTCAGAATAAAAGATGG + Intergenic
1056390653 9:86138230-86138252 TTCACTATCAAAATAAAATAGGG - Intergenic
1056818809 9:89822248-89822270 TTCAGTCTCAAAAAAAAAAAAGG - Intergenic
1057122335 9:92587462-92587484 TGCCATCTCAAAAAAAAGGGGGG + Intronic
1057736787 9:97669927-97669949 TGCCATCTCAAAAAAAAGGTGGG - Intronic
1058064719 9:100536040-100536062 TAATATATCAAAATAAAAGAAGG - Intronic
1058284587 9:103160945-103160967 TGCAATCTCAAAAATGATGATGG - Intergenic
1058660679 9:107265087-107265109 TGAAATATCAAAATATAAAATGG - Intergenic
1058777748 9:108301919-108301941 AGCAATCTCAAATTACTAGATGG - Intergenic
1058855847 9:109061571-109061593 CTCTATCTCAAAAAAAAAGAAGG - Intronic
1059170621 9:112121223-112121245 TGCAATCAGAAAAACAAAGAAGG - Intronic
1059920662 9:119156935-119156957 TTCAATCTCAAAGTAAGATATGG - Intronic
1059922966 9:119178378-119178400 TCTAATCTCAAAATGAAATATGG - Intronic
1060708003 9:125824441-125824463 TGCATTCTCATAATAAAGAAAGG - Intronic
1060800598 9:126542686-126542708 CTCCATCTCAAAATAAAAAAAGG + Intergenic
1062661378 9:137636218-137636240 TGCAATCTAAAAATGAAATGTGG - Intronic
1185559758 X:1050502-1050524 TGCTATCTCAAAAAAAAAAAAGG + Intergenic
1186120559 X:6356595-6356617 TGCAGTCTCAGAAACAAAGAAGG + Intergenic
1187821819 X:23296091-23296113 TGCAATTTCACAATAACACATGG + Intergenic
1188144902 X:26599602-26599624 TGCAATCTGAAAATATTAAATGG + Intergenic
1189360652 X:40348209-40348231 TGGAATCCCAAAATGACAGATGG - Intergenic
1189437873 X:41008743-41008765 GGCAATCTAAAAATGAAAAATGG - Intergenic
1189758830 X:44300053-44300075 TGCAAATACAAAATAAAGGAAGG + Intronic
1192734978 X:73842351-73842373 TGGAAACACAAAATAAAGGATGG + Intergenic
1193299206 X:79869073-79869095 TGCAAGGTCAAAATGAAAAAAGG + Intergenic
1193427131 X:81353286-81353308 TGCAACCTCAAAATCTAAGAAGG - Intergenic
1193439564 X:81522493-81522515 TGAAACCTCTAAATAAAAAAAGG + Intergenic
1193514090 X:82441791-82441813 TGTAAACTTAAAATAAAAGTTGG + Intergenic
1193798651 X:85908693-85908715 TGCATTCTGAAAAAACAAGATGG + Intronic
1193828222 X:86253425-86253447 AGCAATAGCAAAATAATAGAAGG - Intronic
1194021776 X:88700386-88700408 TGGAATCCTAAAATAAAAGCAGG - Intergenic
1194076603 X:89401626-89401648 TGCAATGTCAAGAAGAAAGAAGG - Intergenic
1194276908 X:91896427-91896449 AGCATTCTCAATATAAAATAAGG - Intronic
1194378748 X:93167535-93167557 TCAATTCTCAAAATACAAGAAGG + Intergenic
1194729769 X:97439738-97439760 CTCTGTCTCAAAATAAAAGAGGG + Intronic
1195144920 X:102003708-102003730 TGCAATCAGAAATTAAAAAAGGG + Intergenic
1195393575 X:104387885-104387907 TTCCATCTCAAAAAAAAAAATGG - Intergenic
1195696239 X:107669625-107669647 CGCCATCTCAAAAAAAAAGGAGG - Intergenic
1195995323 X:110725769-110725791 AGCAATGGCAAAAGAAAAGATGG - Intronic
1196081906 X:111641615-111641637 TCCTATCTCAAAACAAAAAAAGG - Intergenic
1196287191 X:113896649-113896671 TGTAGTCTCCAAAGAAAAGAAGG - Intergenic
1196635776 X:118001046-118001068 AACAATCTCAGAATAAAGGATGG + Intronic
1197161594 X:123329325-123329347 TGCAATTTTAAAATATAAGCAGG + Intronic
1197535412 X:127681951-127681973 TGAAATCTAGCAATAAAAGAGGG + Intergenic
1199128661 X:144157537-144157559 TGCAAGTTCAAAATCAAACAGGG - Intergenic
1199180644 X:144849538-144849560 AGCAATTTCAAAAAAAAAAATGG + Intergenic
1199436405 X:147818154-147818176 TACAATACCAAGATAAAAGAGGG + Intergenic
1199485380 X:148341356-148341378 TATAAACTCAAAATAAAGGAAGG + Intergenic
1200429245 Y:3057146-3057168 TGCAATGTCAAGAAGAAAGAAGG - Intergenic
1200594255 Y:5118526-5118548 AGCATTCTCAATATAAAATAAGG - Intronic
1200937166 Y:8748433-8748455 TGGAGTCTCAAAAAAAAAGAAGG + Intergenic
1202075766 Y:21036709-21036731 TACAAGGTCCAAATAAAAGAAGG + Intergenic