ID: 1078840452

View in Genome Browser
Species Human (GRCh38)
Location 11:15072612-15072634
Sequence CACCTGCTCCCCTCCGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078840452 Original CRISPR CACCTGCTCCCCTCCGTGGG TGG Intronic
900512454 1:3067089-3067111 AACCTGCTCGCCCCAGTGGGTGG - Intergenic
900589207 1:3452269-3452291 CACCTGCTCCCCTCCCTCCCTGG - Intergenic
900628052 1:3618428-3618450 CACCTGCCCCTCGCCGTGTGGGG - Intergenic
901850086 1:12009505-12009527 CAGCTGCTCCCTACTGTGGGTGG + Intronic
902503066 1:16923217-16923239 TCCCTGCTCCTCTCAGTGGGTGG + Intronic
902649066 1:17824933-17824955 CATCGTCTCCCCTCAGTGGGAGG - Intronic
904044127 1:27600176-27600198 CCCCCGCCCCCCTCCCTGGGGGG + Intronic
904726111 1:32549522-32549544 CTCCTGATTCCCTCCCTGGGGGG - Intronic
905900080 1:41575567-41575589 CGCCGGCTCCCCTCTCTGGGAGG + Exonic
914505157 1:148282195-148282217 CGCTTCCTCCCCTCAGTGGGGGG - Intergenic
914507408 1:148301953-148301975 CGCTTCCTCCCCTCAGTGGGGGG + Intergenic
914675366 1:149904005-149904027 CCCCTGCTCCCCTCCCTGTGAGG + Exonic
917218643 1:172704144-172704166 CACCTCTTCCCCACTGTGGGTGG + Intergenic
918445195 1:184610469-184610491 CTCCTGCTCACCTCCTTGTGGGG + Intronic
922925255 1:229342592-229342614 CCCCTGCTCCCGTCCGGGCGGGG - Intronic
1063173099 10:3527409-3527431 CAGACGCTCCCCTCCCTGGGAGG + Intergenic
1064194413 10:13233699-13233721 CACCTGCCCTGCCCCGTGGGTGG + Intronic
1064939856 10:20721770-20721792 TACATGCTCCCAGCCGTGGGAGG - Intergenic
1068582210 10:58754603-58754625 CTCCTGCTCCCTGCCGTGTGAGG - Intronic
1072718550 10:97767157-97767179 CTCCAGCTCCCCTCTGTCGGTGG - Exonic
1073176298 10:101559592-101559614 CCCCTTCTCCCTCCCGTGGGTGG + Intergenic
1073329660 10:102661807-102661829 CATCTTCTCCCATCCGAGGGTGG + Intergenic
1074605677 10:114962619-114962641 CACCAGCTGCCTTCAGTGGGTGG + Intronic
1074859126 10:117496965-117496987 CCCCTTTTCCCCACCGTGGGAGG - Intergenic
1075023567 10:118968024-118968046 CACCTCCTGCCCTCAGTGGTTGG + Intergenic
1076752759 10:132551926-132551948 CACCTGGACCCCTGTGTGGGGGG - Intronic
1077276747 11:1715030-1715052 CCCCTGCCCCCCTCCATGGAAGG - Intergenic
1078840452 11:15072612-15072634 CACCTGCTCCCCTCCGTGGGTGG + Intronic
1081639945 11:44746160-44746182 CAGCAGCTGCCCCCCGTGGGTGG + Intronic
1081873091 11:46391993-46392015 CCCCTGCTCCCCTGCGTCGCTGG - Intergenic
1082799720 11:57405802-57405824 CACCAGTTCCTCTGCGTGGGTGG - Intronic
1084128644 11:67118070-67118092 CCCGCGCACCCCTCCGTGGGGGG + Intergenic
1084352351 11:68611427-68611449 CACTTGCTCTCCTCTGTGGCTGG + Intronic
1084939907 11:72606994-72607016 CAGCAGCTCTCCTCCCTGGGCGG + Intronic
1085622811 11:78050170-78050192 CACCTGCTGCCATCCTTTGGGGG - Intronic
1086424700 11:86672117-86672139 CACCTGCTCGGCTCCGCGCGGGG + Intronic
1096878061 12:54645754-54645776 CACCTGCTCCCCGACCAGGGTGG - Intronic
1102011482 12:109621894-109621916 CACCTGCTGCCCAAGGTGGGCGG + Intergenic
1107014201 13:35695663-35695685 CACCTGGGCCTCCCCGTGGGTGG + Intergenic
1107428600 13:40318207-40318229 AACCTGCTCCCTTCTGAGGGAGG + Intergenic
1111291604 13:86178358-86178380 CACCTGCTCAGCTCCTGGGGAGG + Intergenic
1112505202 13:99971010-99971032 CCGCTGCTCCCCTCCGAGCGGGG + Exonic
1113429811 13:110240350-110240372 ATCCTGCTCCCCTCCTTGTGTGG - Intronic
1113757040 13:112819781-112819803 CACCTGGCCCGCTCCGTGTGCGG - Intronic
1119420663 14:74506045-74506067 CACCTCCAGCCCCCCGTGGGCGG + Exonic
1119832181 14:77713018-77713040 AATCTCCTCCCCTCCTTGGGTGG - Intronic
1122282172 14:100629844-100629866 ACCCTGCTCCCCGCAGTGGGGGG - Intergenic
1122337910 14:101005915-101005937 CCCCTGCTGTCCTCAGTGGGTGG + Intergenic
1122825590 14:104368988-104369010 CATCTGCTCCCCTCCTCTGGAGG + Intergenic
1122891575 14:104734511-104734533 CACAGGCTCCCCTCTCTGGGGGG - Intronic
1125318002 15:38452992-38453014 CATCTGCTCCACTCCTGGGGAGG - Intergenic
1126995240 15:54435562-54435584 CACCAGGTCCTCTCGGTGGGTGG + Intronic
1128451273 15:67807157-67807179 CACCTGCCCCCAGCCCTGGGGGG - Intergenic
1129879336 15:78996629-78996651 AACAGGCTCCCCTCCGAGGGTGG + Intronic
1132145155 15:99425189-99425211 CGCCTGCTGCCTTCCATGGGAGG + Intergenic
1132433583 15:101779288-101779310 CACCTAGTCCCCGCTGTGGGAGG + Intergenic
1132639503 16:971147-971169 CACCCGCTCCCGCGCGTGGGCGG - Intronic
1132847601 16:2007595-2007617 GGCAGGCTCCCCTCCGTGGGAGG - Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1133609737 16:7422304-7422326 CACTTGCTCTCCTGTGTGGGTGG - Intronic
1136392535 16:29974477-29974499 CACCCCCTCCCCTCCAGGGGAGG + Exonic
1137029316 16:35507017-35507039 CACCGGTTCCCCACTGTGGGTGG + Intergenic
1138249187 16:55489325-55489347 CATCTGCCCCCTTCCATGGGAGG + Intronic
1140331516 16:74061691-74061713 CACCTGCTACCCTTCTGGGGAGG - Intergenic
1141808937 16:86361029-86361051 CACCAGGACCCCTCAGTGGGAGG + Intergenic
1142102823 16:88284692-88284714 CACCTGCTGCTCTCCTTGGGAGG - Intergenic
1142623933 17:1180492-1180514 CACCCGCCCCCCTCCATGTGTGG - Intronic
1143098719 17:4492890-4492912 TGCCTTCTCCCCACCGTGGGTGG + Intergenic
1143115859 17:4581649-4581671 CACCTGCACACCTGCCTGGGTGG - Intergenic
1143646768 17:8235251-8235273 CACCTGCTCCAGTCAGTGGGAGG - Exonic
1146985341 17:37211075-37211097 CCCCTGCTCTCCTTCATGGGAGG - Intronic
1147381325 17:40057971-40057993 CACCTGCTGCCCATAGTGGGGGG - Intronic
1147976032 17:44248548-44248570 CAGCAGCTCCCCTCCGAGGTTGG + Exonic
1148892798 17:50820090-50820112 CACCTTCTACCCTCAGTGGTGGG + Intergenic
1151391895 17:73793028-73793050 CTGCTGCTCCCCTCCCTGGCTGG - Intergenic
1152008165 17:77695268-77695290 CCCCTGGGCCCCTCAGTGGGAGG - Intergenic
1152322458 17:79615592-79615614 CCCCTGCTCCCCTCTGTGCCCGG + Intergenic
1152521614 17:80859868-80859890 CCCCTGCTCCCTCCTGTGGGCGG - Intronic
1153591269 18:6675974-6675996 TCCCTGCTCCCCTCCCTGGGTGG + Intergenic
1154363913 18:13688977-13688999 CACATGCTCCCTCCCGTGAGGGG + Intronic
1155663737 18:28282283-28282305 CACCCGCCCCCCTCCCTGTGTGG + Intergenic
1157201145 18:45660971-45660993 GAGCTGCTGCCCTCCCTGGGTGG + Intronic
1157862303 18:51152242-51152264 CACCTGCTCCACTGCCTTGGGGG - Intergenic
1160972482 19:1775683-1775705 CACTCCCTCCCCTCCGGGGGGGG - Exonic
1165113530 19:33515349-33515371 CACCTGCTCACCCTCCTGGGAGG - Intronic
1165391462 19:35541490-35541512 AGCCTGCTCCCCTCAATGGGGGG - Intronic
1166365823 19:42278030-42278052 CACCTGCTGCCCTCTGATGGAGG - Intronic
1166375303 19:42324270-42324292 CACCTGCTTCCCGGCCTGGGAGG - Intronic
1167505493 19:49869141-49869163 CCCCTGCCCCCCACCTTGGGTGG + Exonic
1168686028 19:58350224-58350246 CGCCTGCTCCCCGCCGGGGTAGG + Intronic
925132337 2:1502920-1502942 CACCTGCTCCCCAGGGTGAGGGG - Intronic
926591132 2:14741374-14741396 CTCCTGTTCCCCTCCTTTGGAGG + Intergenic
927708600 2:25311921-25311943 GACCTGCTCCCGTCCATTGGTGG + Intronic
930356937 2:50333174-50333196 CCTGTGCTCCCCTACGTGGGTGG + Intronic
930715825 2:54593380-54593402 AACCAGCAGCCCTCCGTGGGAGG - Intronic
933706342 2:85293461-85293483 CACCTGCTCGGCTCCTGGGGAGG - Intronic
934504485 2:94880031-94880053 CAGCTGCCCCCCTCCGTGTTGGG + Intergenic
936055684 2:109260386-109260408 CACCTGCTCTCCTGCTTTGGTGG - Intronic
937216601 2:120317119-120317141 CACCTGCTTCCCTTGGTGAGTGG - Intergenic
937345601 2:121123539-121123561 GTCCTGCTGCCCTCCGTTGGTGG - Intergenic
947133494 2:226954022-226954044 CACCTGCTCTTCTTCCTGGGTGG + Intronic
948946569 2:241223560-241223582 CACCTGCTCCCAGCTGTGGGTGG - Intronic
1169220667 20:3820564-3820586 CAAGCGCTCCCCTCCGTGGCAGG - Exonic
1173503597 20:43570536-43570558 CACCTGCTCCCCGCCCTGTGCGG - Intronic
1173518685 20:43683136-43683158 CTACTGCTCCCCTCCATGGGTGG - Intronic
1173571721 20:44081518-44081540 CAGCTGCTCCCCTCCCTGACAGG + Intergenic
1173868762 20:46329125-46329147 CACCTGCCTCCCTCCCTCGGGGG + Intergenic
1175029516 20:55938373-55938395 CAACACCTCCCCTCCTTGGGAGG + Intergenic
1176172369 20:63701758-63701780 CACCTGCTCCCCTTGCTGTGGGG + Intronic
1176304973 21:5118555-5118577 CACCTGCTGCTCTCCCTGTGGGG - Intronic
1176383884 21:6127452-6127474 CACGTGCTCGCCTCCCTCGGAGG + Intergenic
1179143432 21:38747428-38747450 CATCTGCTCCACTCCGGAGGAGG + Intergenic
1179613457 21:42566781-42566803 CAGCTGCTGCCCTTCGAGGGTGG + Intronic
1179712222 21:43269777-43269799 CACCTGCTTCCCGCAGAGGGAGG + Intergenic
1179739590 21:43410786-43410808 CACGTGCTCGCCTCCCTCGGAGG - Intergenic
1179852082 21:44143475-44143497 CACCTGCTGCTCTCCCTGTGGGG + Intronic
1180085462 21:45506052-45506074 CACCTGCTCCCATCCCTGTCCGG - Intronic
1181023072 22:20113534-20113556 CATGTACTCCCCTCCCTGGGTGG - Intronic
1182362042 22:29752374-29752396 CACCCCCTCCACTCCATGGGGGG + Intronic
1182420461 22:30246212-30246234 CACCTGCTCCCGTCCCAGGCCGG + Intronic
1184387648 22:44185484-44185506 CACCTCCTCCCCTCTCTGGCTGG + Intronic
1184390602 22:44201129-44201151 CACCTGCTTCCCTGGGCGGGCGG + Intronic
1185237111 22:49720504-49720526 CACAGGCTCCTCTCCTTGGGTGG + Intergenic
1185276316 22:49951516-49951538 TACCTGCTCCCCGCCCTGGCTGG - Intergenic
1185371620 22:50463489-50463511 CACCTGCTGCCCTCCCTGCCAGG - Intronic
952275545 3:31872243-31872265 CATGTGCTTCCCTCTGTGGGTGG - Intronic
953133960 3:40166953-40166975 CTCCTGCTCCTCTCTGTGGGGGG + Intronic
955007678 3:54984865-54984887 CCCCTGCACCCCCCAGTGGGAGG - Intronic
961740935 3:129032830-129032852 CAGCTGTTCCGCTCCGTGGAGGG + Exonic
967983047 3:195077116-195077138 CCCCTGCTGCTCTCAGTGGGTGG + Intronic
968039822 3:195579573-195579595 CCCATGGTCCCCTCTGTGGGCGG + Intronic
968133929 3:196208361-196208383 CTCCTGCTTCCCCACGTGGGCGG + Intronic
970860802 4:20700526-20700548 CAGCTGCCCCCCACCGGGGGGGG - Exonic
971927639 4:33034128-33034150 CACCTGCTCCCCACAGTGTAAGG - Intergenic
972331285 4:38066688-38066710 CCCCAGCTCCCCTCCAGGGGGGG - Intronic
973685528 4:53365891-53365913 CACCTGCTCCCATCCTTGCTGGG + Exonic
977979702 4:103307341-103307363 CAGCTGCTCCTCACCGTGGAGGG - Intergenic
981576511 4:146211675-146211697 CACCGCCTCCTCTCCGTGGTGGG + Intergenic
984824775 4:183914685-183914707 CACCTGCTCCCCTCCAAGAAGGG - Intronic
984878978 4:184393805-184393827 GAACTGCTCCCCTCAGGGGGAGG - Intronic
985472787 5:55986-56008 CACCTACTTCCCTCTGTTGGTGG + Intergenic
990456691 5:55995253-55995275 CCCCACCTCCCCTCTGTGGGCGG + Intergenic
992780756 5:80124851-80124873 CAACTACTCCCCACCCTGGGTGG - Intronic
993019664 5:82576644-82576666 CTCCCACTCCCCTCCATGGGAGG - Intergenic
1002104712 5:176874380-176874402 CACCTGCTCAGCCCCCTGGGTGG + Exonic
1002387005 5:178875805-178875827 CACCTGCTGCCCTCAGTCTGGGG - Intronic
1003496322 6:6666637-6666659 CACCTGCCCTCCTCCTTGGCAGG - Intergenic
1007166136 6:39830403-39830425 CACCTGCCTCCCTCCCTGGGAGG - Intronic
1009526343 6:64751254-64751276 CACCAACTCCTCTGCGTGGGAGG - Intronic
1011659483 6:89581880-89581902 CACCTGCTCCACACAGTGTGTGG - Intronic
1015910270 6:138162184-138162206 CACCTGCTCGCCGCGGCGGGAGG + Intronic
1019178930 6:170175445-170175467 CACCTGCTCACCTCAGCGGCTGG + Intergenic
1019687733 7:2390977-2390999 CACCTGCCCCACTCAGCGGGGGG - Intergenic
1021312678 7:19112616-19112638 CACGGTCTCCCCTGCGTGGGTGG - Intronic
1023835517 7:44065194-44065216 CACCTGCTCCTCCCCGTGCTTGG + Exonic
1032087905 7:128893315-128893337 CACCTGCTTCCCTCCTAGGCTGG - Exonic
1032405433 7:131652386-131652408 CACCTGCTCCTGGCCTTGGGGGG - Intergenic
1034063327 7:148113215-148113237 CATCTGCTCCGCTTCTTGGGAGG + Intronic
1035052237 7:156005547-156005569 CACCTTCTCCCTGCTGTGGGGGG - Intergenic
1035851510 8:2923658-2923680 CACCTGCTCACCACAGTGGGAGG - Intergenic
1037763165 8:21755729-21755751 CACCTGCTCCCCTCTGTGCCTGG - Intronic
1037907417 8:22723764-22723786 CACCAGCTCCACTCCCAGGGTGG + Intronic
1040594245 8:48822202-48822224 CACCATCTCCCCGCTGTGGGAGG - Intergenic
1043954052 8:86341727-86341749 TGCCTGCTCCCCACTGTGGGCGG - Intergenic
1046115625 8:109779924-109779946 AACCTGCTTCCCTCAGTGGGAGG + Intergenic
1046794217 8:118353472-118353494 TTCCTGCTCTCCTCCGTGTGAGG + Intronic
1048323723 8:133422575-133422597 CACCTCCTTTCCTCTGTGGGAGG - Intergenic
1048523926 8:135183672-135183694 CACCTGCTCACCTCCTGGGGAGG - Intergenic
1049329779 8:142044223-142044245 CACATGCTCCCACCCGTGCGGGG + Intergenic
1049382800 8:142325742-142325764 GACCTCCTCCCCTCCCTTGGTGG - Intronic
1049591923 8:143466575-143466597 CCCCTGCTTCCCTCCCTGGGTGG - Intronic
1049619331 8:143590941-143590963 CACCTGGCCCCCTCCTGGGGAGG - Intronic
1049741352 8:144242533-144242555 CCCCAGCTCCCCTGCGTGGCAGG - Intronic
1049756730 8:144314113-144314135 CAGCTGCTTCCCTGCGGGGGTGG - Exonic
1057199310 9:93131859-93131881 CAACTGCTCACCTCCCAGGGTGG - Intronic
1187050575 X:15691717-15691739 CACCTGCTCCCCAATGTTGGAGG - Intronic
1188479462 X:30622350-30622372 CACCTGGCCCCCACCTTGGGTGG - Intergenic
1192161024 X:68787564-68787586 CACCTTCTCCCAGCCATGGGTGG + Intergenic
1197335607 X:125206106-125206128 CAACTGTTCCCTTCCCTGGGTGG + Intergenic