ID: 1078843194

View in Genome Browser
Species Human (GRCh38)
Location 11:15097726-15097748
Sequence AGGGAGAGCACAGTCATCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078843194_1078843203 27 Left 1078843194 11:15097726-15097748 CCCACGATGACTGTGCTCTCCCT No data
Right 1078843203 11:15097776-15097798 ATGAGGCTGATGCCAGGAGATGG No data
1078843194_1078843201 21 Left 1078843194 11:15097726-15097748 CCCACGATGACTGTGCTCTCCCT No data
Right 1078843201 11:15097770-15097792 CACACCATGAGGCTGATGCCAGG No data
1078843194_1078843200 10 Left 1078843194 11:15097726-15097748 CCCACGATGACTGTGCTCTCCCT No data
Right 1078843200 11:15097759-15097781 CACAGATTCTTCACACCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078843194 Original CRISPR AGGGAGAGCACAGTCATCGT GGG (reversed) Intergenic
No off target data available for this crispr