ID: 1078845143

View in Genome Browser
Species Human (GRCh38)
Location 11:15113715-15113737
Sequence CTGGGGGCCCAGGGCTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 10, 3: 70, 4: 518}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078845143_1078845147 -10 Left 1078845143 11:15113715-15113737 CCTTCTGAGCCCTGGGCCCCCAG 0: 1
1: 0
2: 10
3: 70
4: 518
Right 1078845147 11:15113728-15113750 GGGCCCCCAGAGAGCTGAGGAGG 0: 1
1: 0
2: 4
3: 39
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078845143 Original CRISPR CTGGGGGCCCAGGGCTCAGA AGG (reversed) Intronic
900146767 1:1162032-1162054 CTGGGGGACCAGGGGTCTGGGGG - Intergenic
900238231 1:1602513-1602535 CTGGGTCCCCATGGCTCAGCAGG - Intergenic
900275798 1:1826653-1826675 CTGGGATCCCAGGGCTCACTTGG - Intronic
900290589 1:1922001-1922023 CTGGGGGCTGGGGGCTCTGAGGG + Exonic
900310844 1:2032504-2032526 ATAGGGGCCCAGGCCGCAGATGG + Intergenic
900368882 1:2322767-2322789 CGGGGGGCCGAGAGCTCAGTGGG + Intronic
900460854 1:2801602-2801624 CTGGGTCCCCAGGGCACAGCCGG - Intronic
900639233 1:3680974-3680996 CAGGAGCCCCAAGGCTCAGAGGG - Intronic
900737047 1:4305537-4305559 CTGCCTGACCAGGGCTCAGAGGG - Intergenic
900792978 1:4691793-4691815 GTGGGGGACAAGCGCTCAGAGGG + Intronic
900824233 1:4913486-4913508 CTGGGGGCCCAGGGTGGGGAAGG - Intergenic
900905533 1:5554448-5554470 CTGGGGAGGCAGGCCTCAGAGGG + Intergenic
901022293 1:6261398-6261420 CTGGGGGCCCGGGGGCCAGAGGG + Intergenic
901183790 1:7359209-7359231 CTGGAGACCCAGGGGTCAGTGGG + Intronic
901196693 1:7444267-7444289 CCTGGGGCCCAGGGCAAAGAGGG - Intronic
901678047 1:10898309-10898331 CAGGAGTCCCAGGGGTCAGAGGG + Intergenic
901743145 1:11355607-11355629 CGGGGGGCACGGGGCCCAGAAGG - Intergenic
901921778 1:12541913-12541935 CTGGTGGATCAGGGCTCTGAGGG + Intergenic
901923469 1:12552042-12552064 CTGGGGACCCAGGTCCCAGCAGG + Intergenic
902548384 1:17204931-17204953 CTGGGGGCCCCGGGCGAAGCAGG - Intergenic
902668350 1:17954714-17954736 CTGGGGGCACAGGGGTCGGGGGG - Intergenic
902796358 1:18803220-18803242 CAGGGCGCCCAGGGCACAGAAGG + Intergenic
903182988 1:21614482-21614504 CTGGGTGCCCAGCCCTGAGAAGG - Intronic
903261665 1:22134874-22134896 CTGGGAACCCAGGACTAAGAGGG - Intronic
903845468 1:26277421-26277443 CTGGGGGCCAAGGGCTGATTAGG + Exonic
904276133 1:29385509-29385531 CTGGGGTCCCTGGGCCAAGAGGG - Intergenic
904478183 1:30777792-30777814 CTGGGGGCCGGGGGCTCACCAGG - Intergenic
905284175 1:36868460-36868482 CTGTGGGCACAGGGTGCAGAGGG + Intronic
905461498 1:38125722-38125744 TTGGGAGTCCAGCGCTCAGAGGG + Intergenic
905863189 1:41363507-41363529 CTGGGAGCCCATGGCTCTCAGGG + Intronic
906143639 1:43547695-43547717 ATGGGGGCCCTGGCCTCTGAGGG + Intronic
906530497 1:46520999-46521021 CACAGGGCCCTGGGCTCAGAGGG + Intergenic
906547884 1:46634670-46634692 CTGGGGGCCTTGGGTTCAGAAGG + Exonic
907045832 1:51299540-51299562 GTGGGGCCCCAGAACTCAGAGGG + Intronic
907237307 1:53061603-53061625 CTGTGGGCCCAGGGCCAACAGGG + Intergenic
907456794 1:54581439-54581461 CTGGGGGACTAAGGCACAGAGGG - Intronic
907491339 1:54810755-54810777 CTGGCAGCCCAGGTCCCAGATGG + Intronic
910513992 1:88037426-88037448 CTGGGGGTCCAGGGCTCATATGG - Intergenic
912975726 1:114328636-114328658 CTAGGCGCCCAGGGTGCAGATGG + Intergenic
914213731 1:145605932-145605954 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914914921 1:151813672-151813694 GTGGGGCTCCAGGGCTCAGGAGG - Intronic
915285684 1:154850544-154850566 CAGAGGGCCCAGGGCTCTCACGG - Intronic
915585274 1:156840870-156840892 ATGGGGGTCCAGGGCACTGAGGG - Exonic
915901113 1:159847265-159847287 CAGTGAGCCCTGGGCTCAGAGGG + Intronic
915920675 1:159973290-159973312 ATGCAGGCCCAGGGCTCAGGAGG + Intergenic
917539466 1:175898883-175898905 CTGGGGCTCCAGGGGTCACAGGG + Intergenic
918064478 1:181089879-181089901 AGGGGGGCCAAGGGCTCAGAAGG - Exonic
919724472 1:200873044-200873066 CTGGGGCTCCAGGGCTCTGTGGG - Exonic
919894355 1:201999737-201999759 CTGGGGACCCAGGGCAAATAGGG - Intronic
920182011 1:204137839-204137861 CTGGGAACCCATGGATCAGATGG + Intronic
920498702 1:206472971-206472993 CTGTGGGCTGAGGGCTCAGTGGG + Intronic
920672915 1:208018231-208018253 CTGGAGGCAGAGGGCACAGAAGG - Intergenic
920867919 1:209768708-209768730 CCGGGAGCCGAGGGCTCAGAGGG - Intronic
921080049 1:211732039-211732061 CTGGCAGCCCAGGGCTCTGGCGG - Intergenic
921918621 1:220641944-220641966 CTTGGGACCCAGGGCTCTGGTGG - Intronic
921931283 1:220756270-220756292 GTGTTGTCCCAGGGCTCAGAGGG + Intronic
922223682 1:223627437-223627459 CTGGGGGCTGGGGGCACAGATGG + Intronic
922810034 1:228410215-228410237 CTGTGGTCCCAGGACTCAGGAGG - Intronic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
923224039 1:231922770-231922792 CTGGGGGAGCTGGGCTCAAAAGG - Intronic
923660169 1:235950706-235950728 CTCAGGGCCACGGGCTCAGAAGG - Intergenic
923879623 1:238089170-238089192 CCAAGGGCCCAGGGCTCAGCTGG - Intergenic
1062895578 10:1100891-1100913 CGGGGGGCCCGAGGCTCACAAGG - Intronic
1064251492 10:13709752-13709774 CTGAGGGCCCTTTGCTCAGAAGG + Intronic
1067289952 10:44933326-44933348 CTGGAGGCTCAGGGCTCACTGGG - Intronic
1067348639 10:45456225-45456247 CTGGGGTCCCCAGGCTGAGAAGG + Exonic
1069574470 10:69516941-69516963 CTGGGCCCCCAGGACTCAGTGGG + Intergenic
1069849897 10:71397720-71397742 ATGGGGACCCAGGGCTCAGAAGG - Intronic
1069855537 10:71438996-71439018 CTGGAGGACCAGGGCCCTGATGG + Intronic
1070305873 10:75238843-75238865 CTGAGGGCCCTGCGCTCAGGTGG + Intergenic
1070706420 10:78642406-78642428 CTGGAGGCCCACGGATCATAAGG + Intergenic
1070795832 10:79215768-79215790 CTGAGGGCCCAGGGCATGGAAGG + Intronic
1070923304 10:80202590-80202612 CTGGGGGCAATGGGATCAGAGGG + Intronic
1071497607 10:86179594-86179616 CTGGGGACCCAGGGAGCAGAAGG - Intronic
1071601967 10:86962756-86962778 CTGGGCTCCCAGGGCCCAGAGGG + Intronic
1073121506 10:101124995-101125017 CTGTGGGACCAGGCCTCTGAGGG - Intronic
1073291657 10:102416350-102416372 CTGGGGGCCCAGGGAGCCCAGGG + Intronic
1073564090 10:104520652-104520674 CTGGGGGCCCTGGACCCAGATGG - Intergenic
1074085663 10:110207738-110207760 CTGGGGGCCCGGAGCTCGGCCGG + Exonic
1074419847 10:113299179-113299201 CATGGGGCCCAGGGCTCACAAGG - Intergenic
1074537230 10:114337222-114337244 CTGAGGGCACACGGCTCTGAGGG - Intronic
1074689377 10:115990640-115990662 TTAGGGGCTCAGGGCTCAGAAGG + Intergenic
1075335680 10:121607461-121607483 CAGGGGGCCCCAGGATCAGAAGG - Intergenic
1075666539 10:124234568-124234590 CGTGGGGCCCTGGGCTCAGGAGG + Intergenic
1075702648 10:124479162-124479184 GTGGGGGCCATGGTCTCAGAGGG + Intronic
1076495278 10:130893163-130893185 CTGGGGACCCAGGGCTGAGCTGG - Intergenic
1076911984 10:133394897-133394919 CTGGGGGCCGAGGGGGAAGAAGG + Intronic
1076920894 10:133454239-133454261 CTGGGGGCCCTGAGGTCACAGGG - Intergenic
1077020860 11:416667-416689 CTGGGGGCCCAGCGCGCACGGGG - Intronic
1077162358 11:1119564-1119586 CTGGGGGCTCAGGACTCTGGGGG + Intergenic
1077227116 11:1443260-1443282 TTGGAGGGCCTGGGCTCAGAGGG - Intronic
1077289729 11:1783522-1783544 CTGGGGGCCCTGGGCTGGGAGGG - Intergenic
1077351382 11:2094782-2094804 CAGGGGCCCCAGGGCACAGGTGG - Intergenic
1078182592 11:9025100-9025122 GTAGAGCCCCAGGGCTCAGATGG + Intronic
1078443647 11:11387774-11387796 GTGGGGGCTCAGGACTCAGATGG + Intronic
1078845143 11:15113715-15113737 CTGGGGGCCCAGGGCTCAGAAGG - Intronic
1078932210 11:15921287-15921309 CTGAGGGTCCTGGTCTCAGAGGG - Intergenic
1080283416 11:30584538-30584560 CTGGCGGCCCCGGGCTCCGCTGG + Intronic
1081484191 11:43515385-43515407 GTGGGGGTGCAGGGCTCAGGTGG + Intergenic
1083174149 11:60938902-60938924 CTGCGGGCCCAGGGCTAGGCTGG - Intronic
1083227869 11:61295719-61295741 CTGGGCACCCAGGGGGCAGATGG + Intergenic
1083242624 11:61400489-61400511 CTGGGAGGCAAGGGCACAGAAGG - Intergenic
1083277060 11:61602883-61602905 CAGGAGCCCCAGGCCTCAGATGG + Intergenic
1083804555 11:65066257-65066279 CTGTGGGCCCTGGGCTCAGGTGG - Intergenic
1084036684 11:66515631-66515653 ATGGGGCCCTGGGGCTCAGATGG - Intronic
1084152951 11:67299723-67299745 CTGGGGGAAGAGGGGTCAGACGG - Intronic
1084582413 11:70032276-70032298 CTGCAGGCCCAGGGCTGGGAAGG + Intergenic
1085271790 11:75274040-75274062 CTAGGAGCCCAGGGCTAGGAGGG + Intronic
1085273916 11:75286087-75286109 CTGGGGACCCTGGGCTCCCAGGG - Intronic
1089070564 11:115696395-115696417 TTGGGTCCCCAGGGCCCAGAGGG - Intergenic
1089342227 11:117765840-117765862 CTGTGGGCTCTGGCCTCAGAGGG - Intronic
1089413456 11:118266641-118266663 CTGGGGGCTCAGGAGACAGAAGG + Intergenic
1089586632 11:119513659-119513681 CTGGGGGCCCTGTGAGCAGATGG + Intergenic
1089859257 11:121574247-121574269 CTGGGTGTCCAGGTCACAGATGG - Exonic
1090183255 11:124718953-124718975 CTGGGGGCACAGGGTCCAGACGG - Intergenic
1090383060 11:126340108-126340130 CTGGAGGCACTGGGGTCAGAAGG - Intronic
1090398855 11:126435755-126435777 CTGGGCCCCCAGGCCTCAGTGGG - Intronic
1091298572 11:134490219-134490241 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298583 11:134490260-134490282 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298594 11:134490301-134490323 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091298605 11:134490342-134490364 CTGGAGGCCCAGGGCTGCGGAGG + Intergenic
1091409696 12:231163-231185 CTGGAGACCCAGGGCTCTGCTGG - Intronic
1091432081 12:444932-444954 CTGGTTGCCAAGGGCTGAGAAGG + Intergenic
1091657095 12:2353756-2353778 GTGCAGGCCCAGGGCTGAGATGG + Intronic
1092108939 12:5945398-5945420 CCGGGCGCCCAGGGCGCAGCGGG - Intronic
1092168042 12:6355067-6355089 CTGGGGGACAAGTGCTGAGAAGG - Intronic
1092256424 12:6928549-6928571 CTGAGGGCCGGGGGCTCAGGGGG + Intronic
1093464933 12:19439744-19439766 CGGGGGGCAGAGGGCTCAGGCGG - Exonic
1093809385 12:23473238-23473260 CTGGCTCCCCAGGGGTCAGAAGG + Intergenic
1094470391 12:30796642-30796664 CTGGGGGCCAAGGGAGCAGCGGG - Intergenic
1094846141 12:34362233-34362255 CAGGGGGCCTCGGGCTCAGGGGG - Intergenic
1095989908 12:48027471-48027493 CTGGGGGACCCGGGCTCTGTGGG - Intergenic
1096493852 12:52027732-52027754 CTGGTGGCCCTGGGCACAGGGGG + Intronic
1097186606 12:57199630-57199652 CTGGGTGCCCAGCCCCCAGAAGG + Intronic
1098011254 12:66054838-66054860 CTGAGGTCCCAAGACTCAGAGGG - Intergenic
1098535137 12:71585497-71585519 CTTGGTGCCCAAAGCTCAGAAGG + Exonic
1100390464 12:94142333-94142355 CTGGGGACTAAGGGTTCAGAAGG - Intergenic
1100946878 12:99794703-99794725 GTGGGGGCACAGGGGTTAGAGGG + Intronic
1101789297 12:107912846-107912868 CTGGGGCCCCAGCGCTGACAGGG + Intergenic
1101813106 12:108124591-108124613 CTGTGGTCCCAGGACTCAGAAGG - Intergenic
1102043810 12:109817279-109817301 CTGGGGGCCCTGAGGTCAGGGGG + Intronic
1102443285 12:112979743-112979765 TCGGGGGCCCAGGGCTCTGGGGG - Intronic
1102559747 12:113753804-113753826 CTGGGGGCACTGGGCACAGGAGG - Intergenic
1102987997 12:117294243-117294265 GTCTGGGCCCAGGACTCAGAGGG + Intronic
1102997307 12:117360656-117360678 CTGGGGGCCCGAGGCTGGGAGGG - Intronic
1103007441 12:117432835-117432857 CTGAGGCCCATGGGCTCAGAGGG - Intronic
1103549833 12:121728853-121728875 ATGGGGACCCAGAGCTCATAGGG - Intronic
1103560311 12:121790069-121790091 CGGGGCTCGCAGGGCTCAGAAGG - Intronic
1103617893 12:122166608-122166630 CATGGGGCCCAGAGCTCAGAGGG - Intergenic
1103700051 12:122844566-122844588 CTGTGGGACCAGGGCTCTGCAGG - Intronic
1103704829 12:122865845-122865867 CTGAAGGCCCAGGGCCCAGCAGG - Exonic
1104003531 12:124875676-124875698 GAGGGGGCCCAGGGCTCAGAGGG - Intronic
1104420044 12:128627675-128627697 CAGGGGACCCAGGGCTCACAGGG - Intronic
1105210671 13:18254981-18255003 GAGGGGGCACAGGTCTCAGAAGG + Intergenic
1106229975 13:27814217-27814239 CTGGTGGCCCAGGGTGCAGCGGG + Intergenic
1106264818 13:28100513-28100535 CTGGGGACCCCGGGCTCCGGAGG - Exonic
1106637998 13:31551735-31551757 CAGGGGGCCCAGTCCTAAGAGGG - Intergenic
1109620710 13:64901100-64901122 CTGGGGGCACAGGACACAGTGGG - Intergenic
1111880513 13:93950590-93950612 CTGGGAGACAAGGGATCAGACGG - Intronic
1113318260 13:109206807-109206829 GTGGTGTCCCAGAGCTCAGACGG - Exonic
1113575174 13:111390253-111390275 CTGGGGGTGCAGGGCTCAGAAGG - Intergenic
1113634318 13:111909544-111909566 TTGTGGGCCCTGGGCACAGAGGG + Intergenic
1113673689 13:112194157-112194179 CTGGCTGCTCAGGGCGCAGAGGG - Intergenic
1113707611 13:112444598-112444620 TGAGGGGCCGAGGGCTCAGAGGG - Intergenic
1113879237 13:113614457-113614479 CTGGGCTCCCAGGGCACAAACGG - Intronic
1113893329 13:113748076-113748098 CTGGGGGCCCAAGTCTAAAACGG + Intergenic
1113930736 13:113967656-113967678 CTGGGGTCTCAGGGCCCTGATGG - Intergenic
1114049793 14:18913589-18913611 CTGGGGGCCCAGGGCAGGCAGGG - Intergenic
1114112768 14:19488342-19488364 CTGGGGGCCCAGGGCAGGCAGGG + Intergenic
1114460734 14:22884739-22884761 CTGGGGGCCCCAGGGGCAGAGGG - Exonic
1114614451 14:24060850-24060872 CTGGGGTCCCTGGGCTAGGAAGG - Intronic
1114639086 14:24207062-24207084 CTGAAGGGCCAGGGGTCAGAGGG - Intronic
1115317379 14:32039221-32039243 CTAGGGGCTCAGGTGTCAGAGGG + Intergenic
1118839442 14:69500018-69500040 TTGGGGGCCCTGGACTCACATGG - Intronic
1119204465 14:72783853-72783875 CCGTGGGCCCAGGGCTCTGCAGG - Intronic
1119912147 14:78359395-78359417 CAGAGGGCCCCGTGCTCAGAAGG + Intronic
1120206381 14:81591369-81591391 CTTGGGGCCCAGAGCTCTGAAGG + Intergenic
1121049144 14:90808868-90808890 CTGCGTGCCCAGGGCACAGCTGG + Intronic
1121733823 14:96204652-96204674 CCTGGCCCCCAGGGCTCAGAGGG + Intergenic
1122048768 14:99041291-99041313 CTGGGTGTCCAGGGGTCAGATGG - Intergenic
1122113051 14:99514958-99514980 CATGGAGCCCAGGGCCCAGAGGG + Exonic
1122165224 14:99818115-99818137 GTGGGGGCTCAGGGATAAGAGGG + Intronic
1122267653 14:100554172-100554194 ATGGGAGCCCGGAGCTCAGAGGG + Intronic
1122421026 14:101577507-101577529 CTGGGGGCCCAGAGCCCTGATGG + Intergenic
1122769223 14:104090475-104090497 CTGGAGGCCGAGGCCTGAGAGGG + Intronic
1122900640 14:104780915-104780937 CAGGGGCCCCAGGGCACAGAGGG + Intronic
1123003936 14:105312406-105312428 CTGAGACCCCAGGGCTCTGAAGG + Exonic
1123034910 14:105467998-105468020 GGCGGGGCCCTGGGCTCAGAGGG + Intronic
1123057511 14:105579090-105579112 CTGGGGGCGGAGGGCACAGCCGG + Intergenic
1123080855 14:105692845-105692867 CTGGGGGCGGAGGGCACAGCCGG - Intergenic
1123122940 14:105926540-105926562 CTGGGACCCCTGGGCTCAGGAGG - Intronic
1124105039 15:26729703-26729725 CTGGGGGCATAGGGAACAGATGG - Intronic
1124377314 15:29136347-29136369 CTGGGGCCCCAGGCCTCACCTGG + Exonic
1124393243 15:29278515-29278537 CTTGGAGCCCAGGCCTCACAGGG - Intronic
1124841273 15:33244376-33244398 CTGGGGTCCCAGGCTGCAGATGG + Intergenic
1125721301 15:41846414-41846436 CTGGGGACTCAAGGCTCAGGTGG - Intronic
1125761464 15:42098797-42098819 CTGGCGGCTCAGGGCTCTAAGGG - Intergenic
1125789530 15:42353304-42353326 ATTGGCGCCCAGGGATCAGAAGG - Exonic
1126692702 15:51300106-51300128 CTGGTGGCTCAGGACTCTGAGGG - Intronic
1127775587 15:62262005-62262027 TGGGGGGCCCAGGTCTCAGCTGG - Intergenic
1127898983 15:63327279-63327301 CCGGGGGCCATGGGCTAAGATGG - Intronic
1127959528 15:63880385-63880407 TTGGGGGCCCAGGCCCCACAAGG - Intergenic
1128458069 15:67844118-67844140 CTGTGTGCCCACAGCTCAGAGGG + Intergenic
1128632161 15:69278626-69278648 AAGGGGGGCCAGGGCTGAGAAGG + Intergenic
1128633571 15:69288600-69288622 CAGGTGGGCCAGGGCTCAGGGGG - Intergenic
1129060862 15:72859348-72859370 CTGCTGGCCCACGGCTCACAGGG + Intergenic
1129295820 15:74599506-74599528 CCGGGGGCACATGGCTCAGCCGG + Intronic
1129360313 15:75020229-75020251 CTGGTAGGACAGGGCTCAGAGGG + Exonic
1130370589 15:83283397-83283419 CTGGGGGCCGCGGGCGGAGAAGG - Intronic
1131367467 15:91853163-91853185 CCGGGTGCCCAGGCCTCAGAGGG - Intergenic
1131830689 15:96352882-96352904 CTGCAGCTCCAGGGCTCAGAGGG - Intergenic
1132453566 16:10177-10199 CTCGGTGCCCAGGATTCAGAGGG + Intergenic
1132656722 16:1044561-1044583 CTGGGAGCCCAGGGAGGAGAGGG + Intergenic
1132697633 16:1209050-1209072 CTGGGGCCCCAGGGGGCACAGGG - Exonic
1132713193 16:1278319-1278341 GTGGGGGCCCAGGCCAGAGAGGG - Intergenic
1132729695 16:1355390-1355412 ATTGTGGCCTAGGGCTCAGAAGG + Intronic
1133287736 16:4698360-4698382 GTGGGGGCCCAGGGGCCAGGTGG + Intronic
1135436291 16:22428831-22428853 CAGCCGGCCCAGGGCCCAGATGG - Intronic
1135794960 16:25432887-25432909 CTGGTGGCCCCGGGCCCAGAAGG - Intergenic
1137250575 16:46737763-46737785 CTGGAGGCCCTGGGCACTGAGGG + Exonic
1137562728 16:49513273-49513295 CTGGGAGACCAGGGCCCAGATGG - Intronic
1137576992 16:49606562-49606584 CAGGGGGCTCAGGTCCCAGAGGG + Intronic
1137638513 16:50008549-50008571 CTGGGCCTCCAGGCCTCAGATGG - Intergenic
1138349080 16:56336924-56336946 CCCGAGGCCCAGTGCTCAGAGGG - Intronic
1138558845 16:57788175-57788197 CTGGGGGCCCACGGATAGGAGGG + Intronic
1139437520 16:66944899-66944921 GAGGGGGCCCAGGGCTCAGTGGG - Exonic
1139636194 16:68260008-68260030 CTGCGGGGCCAGGGCCCAGTAGG - Exonic
1139760737 16:69182861-69182883 CTGGGGGCTCACGCCTCAGCTGG + Intronic
1139955437 16:70690869-70690891 CTGGGGGTCCAGGGCATTGAAGG + Intronic
1141089002 16:81117287-81117309 TTTGAGGCCCAGGGGTCAGAAGG - Intergenic
1141609853 16:85175206-85175228 CTGGGGACCCGGGGCCCAGCTGG - Intronic
1141643357 16:85354575-85354597 CTGGGGGGCCAGGGTTCTGCTGG - Intergenic
1141659031 16:85431725-85431747 CTGAGCACCCAGGGCCCAGAGGG + Intergenic
1141668111 16:85476505-85476527 CTGGTGACCCAGGGAACAGAAGG - Intergenic
1141803228 16:86324828-86324850 CTGGGGGCACATGGCACAAAGGG - Intergenic
1141923804 16:87153746-87153768 CTGGGGGACCAGGGGTCAGGAGG + Intronic
1142045506 16:87922664-87922686 CAGCTGGCCCAGGGCCCAGACGG - Intronic
1142197755 16:88746538-88746560 CAAGGGGACCAAGGCTCAGATGG + Intronic
1142263208 16:89052043-89052065 CTTGGGGCCCAGGGCTCCTAGGG - Intergenic
1142275256 16:89115035-89115057 CGGAGGACCCAGGGCTCAAATGG - Intronic
1142290472 16:89191836-89191858 CTGGGAGCCTGGGGCTCAGCTGG - Exonic
1142594166 17:1021441-1021463 CTGGGATGCCGGGGCTCAGAGGG - Intronic
1142898213 17:2995821-2995843 CTGGGGGCCCTGGTCATAGAGGG + Intronic
1143034300 17:3985741-3985763 CTGGGGGAGCAGGGAGCAGAGGG + Intergenic
1143112145 17:4558808-4558830 CTGGTGGCTCGGGGCACAGAAGG - Exonic
1143501882 17:7343957-7343979 GTGGGGCCCCAGGGCACAGCAGG + Intronic
1143734891 17:8904734-8904756 CACGGGGGACAGGGCTCAGAAGG - Intronic
1144807511 17:17977660-17977682 CTGGGGGCCCTGGTCCCCGACGG - Exonic
1144819709 17:18063538-18063560 GTGGTTGCCCAGGGCTCAGAGGG - Intronic
1145262785 17:21364765-21364787 CTGGGTGCTCAGGGCCCAAACGG - Intergenic
1145935949 17:28714943-28714965 CTGGGGACACAGGGCACAGCTGG + Intronic
1146056215 17:29582596-29582618 TTTGGGGCCCAGGGCTCAGTGGG + Intronic
1146118850 17:30171226-30171248 GTGGGAGCCCAGGGCAGAGAAGG - Intronic
1146457695 17:33020171-33020193 CCAGGGACCCAGGGCTCAGCTGG - Intronic
1146524300 17:33552960-33552982 CAGTGGGCCCAGGGTTCAGTTGG - Intronic
1147457563 17:40547712-40547734 CTGGGAGGCCAGTGCTCAGCGGG - Intergenic
1147559856 17:41502025-41502047 CTGTGGGCTCAGGGCTCAGGTGG - Intronic
1147611822 17:41806417-41806439 GAAGGGGCCCAGGGCTGAGATGG + Intronic
1148324649 17:46776237-46776259 ATGGAGGCCCAGGGTGCAGATGG - Intronic
1148437337 17:47694427-47694449 CCGGGGGCCCAGGGCTCGGCCGG + Intronic
1148790828 17:50171719-50171741 CTGGTGGACAAGGGCTCAGCAGG - Intronic
1148822227 17:50366319-50366341 CAGGGCACCCAGGGCTGAGAAGG - Intergenic
1148912329 17:50949620-50949642 TAGGGGGTGCAGGGCTCAGAAGG - Intergenic
1149375724 17:56042208-56042230 CTGGAGGGGCAGGGGTCAGAAGG + Intergenic
1151598472 17:75091845-75091867 TTGGGGGGCCAGGGCGCAGGAGG + Intronic
1151970544 17:77455363-77455385 CCGGGGGCACAGGCCTGAGAAGG - Intronic
1152337217 17:79705811-79705833 CTCAGGGCTCAGGGCTCAGGTGG - Intergenic
1152383429 17:79954459-79954481 CTGGGGCCCCTGGGCTCTCAAGG + Intronic
1152560378 17:81075705-81075727 CTGGGGGAGAAGGGCACAGAGGG - Intronic
1152756673 17:82089934-82089956 CTGGGAGCCCAGTCCCCAGATGG + Intronic
1152774685 17:82193660-82193682 CTGATGGCCCAGGGAGCAGAGGG - Intronic
1152780668 17:82226222-82226244 CTGGGGGCTGTGGGGTCAGAGGG + Intergenic
1152818576 17:82423945-82423967 CAGGGGGAGCAGGGCTCTGAAGG - Intronic
1152887752 17:82862427-82862449 CTGGGGGTCCTTGGCCCAGACGG + Intronic
1152943285 17:83184014-83184036 CTGGGGGCTGAGGCCACAGAAGG + Intergenic
1153415382 18:4840681-4840703 CTTGGGGCCCAGGAGACAGAGGG + Intergenic
1154209485 18:12367275-12367297 CTGGTGGTCCAGGTTTCAGAAGG - Exonic
1156321510 18:36029428-36029450 CTTCGGGACCAGGGCTCAGCAGG + Intronic
1157122202 18:44921768-44921790 GTGGGGGCCCAGGGGACGGAGGG + Intronic
1158339327 18:56448431-56448453 AGTGGGGGCCAGGGCTCAGAGGG + Intergenic
1158730711 18:60019624-60019646 CGCAGGGCCCAGTGCTCAGAAGG - Intergenic
1159985525 18:74836467-74836489 CTGGGGGAGCAGGGCTCACTCGG - Intronic
1160280997 18:77490376-77490398 CTGGGGGATCAGGGCAGAGAGGG + Intergenic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1160564487 18:79778602-79778624 ATCGGGGCTCAGGGCTCAGCAGG - Intergenic
1160712573 19:559253-559275 CTGGGGGCCGAGGGCCTGGACGG - Intergenic
1160784006 19:891436-891458 ATGGGGGCCAAGGGCACAGCCGG + Intronic
1160810932 19:1012670-1012692 CCTGGGGCCCAGGGCTCAGCAGG - Intronic
1160912484 19:1481371-1481393 CCGAGGCCCCAGGGCTCAGGTGG - Intergenic
1161058098 19:2200614-2200636 CTGGGGGAGCAGGGCCCAGCCGG - Intronic
1161235165 19:3194021-3194043 CTGGGGGAGCAGGGCTGAGAAGG + Intronic
1161283221 19:3456692-3456714 CGGGGGGCTCAGGGCGAAGAGGG + Intronic
1161392918 19:4030829-4030851 CTTGGGGCCCAGGCCTCAGTGGG + Intronic
1161441033 19:4291703-4291725 CTGGGGTCCCAGAGCTCTCAGGG - Intergenic
1161478417 19:4498743-4498765 CAGGGGTCCCAGGGCCCCGATGG - Intronic
1161588910 19:5119831-5119853 CGGGAGGCCGAGGGCGCAGAAGG + Exonic
1161604402 19:5206688-5206710 CTGGGGGTCCAGGCCTCAGGAGG + Exonic
1161778504 19:6276888-6276910 CTGGGAGCCCAGAGCACAGTGGG + Intronic
1162744465 19:12790962-12790984 CTGGGGGTCCCGGGCTCAGAAGG - Intronic
1163628111 19:18402350-18402372 CTGGGGGTCCAGGGGTCTGGTGG + Intergenic
1163637341 19:18443454-18443476 CTCAGGGCCCAGGGATCACATGG - Exonic
1164478651 19:28594537-28594559 CTGGGCGCTCAGGGCTCTGCTGG + Intergenic
1164847224 19:31442947-31442969 CTGTGGTCCCAGGACTCAGGAGG + Intergenic
1165076307 19:33281649-33281671 CCAGTAGCCCAGGGCTCAGATGG - Intergenic
1165832380 19:38736091-38736113 TTGGGTGCCCGGGGCTCACACGG + Exonic
1165832600 19:38736885-38736907 CTGGGGGGCCAGGTCTCAGAGGG - Intronic
1165838860 19:38774900-38774922 CTGGGGGCCTGGGACGCAGAGGG - Intergenic
1166193844 19:41193654-41193676 GTGGGGGACCAGGGCTAGGAGGG + Intronic
1166368738 19:42290292-42290314 CTGGGGGCTCAGGGTCCAGTGGG - Exonic
1166438471 19:42789622-42789644 CTCGGGGCTCTGGGCTCAGAAGG - Intronic
1166467358 19:43044271-43044293 CTCAGGGCTCAGGGCTCAGAAGG - Intronic
1166473495 19:43100356-43100378 CTCAGGGCTCAGGGCTCAGAAGG - Intronic
1166510995 19:43408418-43408440 CTACCGGCCCACGGCTCAGATGG - Intronic
1167521590 19:49958965-49958987 CTGGGGGCCCAGGAGTCTGGAGG - Intronic
1167776900 19:51564400-51564422 CCAGGAGCCTAGGGCTCAGATGG - Intergenic
925296047 2:2778200-2778222 CTGGAGACCCAGCGCTGAGAAGG + Intergenic
925712670 2:6757304-6757326 CTGGGTGGCCAGGGCTGAGTGGG - Intergenic
925722498 2:6842670-6842692 CTGGGAACCTAAGGCTCAGAAGG - Intronic
926588900 2:14718910-14718932 TGGGGGGGCCAGGGTTCAGAGGG - Intergenic
926705529 2:15834846-15834868 CTGGGGAGCCAGGGCTCACTGGG - Intergenic
927866530 2:26591491-26591513 CTGGGGCCCTAGGGCACAGCTGG - Intronic
929781230 2:44958407-44958429 CTGGGGGCCCTGAGCTCTGGGGG + Intergenic
930693878 2:54391443-54391465 ATGTGGCCCCAGGCCTCAGAGGG + Intergenic
931637632 2:64355111-64355133 CTGTGGGACCAGCCCTCAGAAGG - Intergenic
931694555 2:64861948-64861970 GATGGGGCCCAGGGCACAGATGG - Intergenic
933184091 2:79259621-79259643 TTGGGGGCCCAGGGGTGAGGTGG + Intronic
935670476 2:105552374-105552396 CATGGGGCCCTTGGCTCAGAGGG - Intergenic
936346469 2:111679257-111679279 CTGGGTCCCCAGGCCTCAAAAGG + Intergenic
937072518 2:119074818-119074840 CTGGGAGCCCTGGGTTCGGATGG + Intergenic
937587010 2:123565034-123565056 ATGGGGGCCCAGGGATGAGAGGG + Intergenic
938064301 2:128272821-128272843 CTGAGGGCCCCGGACTTAGATGG - Intronic
938068660 2:128295106-128295128 AGAGGGACCCAGGGCTCAGAGGG - Intronic
938288425 2:130136958-130136980 CTGGGGGCCCAGGGCAGGCAGGG + Intergenic
938468103 2:131535978-131536000 CTGGGGGCCCAGGGCAGGCAGGG - Intergenic
938966652 2:136394573-136394595 TTGGGTCCCCAGGGCTCACATGG + Intergenic
939958986 2:148549749-148549771 ATGGGGGCACAGGGCTGTGAGGG - Intergenic
940786686 2:157989034-157989056 GTGGGGATCCAGGGCACAGATGG + Intronic
942292495 2:174486742-174486764 CCGCGGGGCCAGGGCGCAGAGGG + Intronic
943626140 2:190202109-190202131 ATAGTGGCCCAGGGCACAGAAGG - Exonic
944731344 2:202520789-202520811 CCTGGGGCACTGGGCTCAGAAGG + Intronic
945024377 2:205606219-205606241 CTTGGGACCCAGGGCTCTGATGG + Intronic
945197634 2:207251953-207251975 GTGGGGGCACAGGCCACAGAGGG - Intergenic
946192860 2:218016564-218016586 CTGAGGGCCCCGGGCTGAGTGGG - Intergenic
947598151 2:231426988-231427010 CTGGAGGCTGAGGGCTCAGCAGG - Intergenic
947752662 2:232540884-232540906 CTGCTGGCCCTGGGGTCAGAGGG - Intronic
948197155 2:236104498-236104520 TTGGGGGCACAGGGCTGTGAGGG + Intronic
948229795 2:236341626-236341648 GAGTGGCCCCAGGGCTCAGAGGG + Intronic
948825352 2:240571152-240571174 CTGGCAGCCCAGGGCTCAGCAGG + Intronic
948826875 2:240577251-240577273 CTGAAGGCCCAGGGCCCAGCAGG - Intronic
948888719 2:240896718-240896740 CCAGGGGTCCAGGGCCCAGATGG - Intronic
1169009352 20:2237408-2237430 CCGGGGGCCCAAGGCTCACTCGG + Intergenic
1169037314 20:2463843-2463865 CCGGGGGCCCAGGGATCGGCAGG - Exonic
1169120546 20:3093157-3093179 CCTGGGGCCTGGGGCTCAGACGG - Intergenic
1169198774 20:3697513-3697535 GTGGGGGCCCTGGGCAGAGAGGG + Intronic
1169706905 20:8516226-8516248 CAGGAGGACCTGGGCTCAGAGGG - Intronic
1170298741 20:14858332-14858354 CTGGGGTCCAAGGGCTCAACAGG - Intronic
1171291816 20:23986672-23986694 GAGGGGGCACAGGTCTCAGAAGG + Intronic
1172444688 20:34986863-34986885 CTGGGGACACAGGGCAGAGAAGG - Intronic
1172773521 20:37394802-37394824 CTGTGGGCCTGGGGCTCAGCGGG + Intronic
1173257250 20:41403247-41403269 CTGGGGGCGCAGGGCTGCGCAGG - Exonic
1174172687 20:48627254-48627276 GCGGGGGCTCAGGGCTGAGAGGG + Intronic
1174762243 20:53217294-53217316 CTGGGCGCTCAGGGAGCAGAAGG + Intronic
1175471440 20:59232484-59232506 CGGGGGTCCCAGGGCTGAGGCGG - Intronic
1175794851 20:61765206-61765228 CTGGCCGCTCAGGGCTCGGAGGG + Intronic
1175936867 20:62518023-62518045 CTGGGGGCCCAGGGATCCTGGGG - Intergenic
1176230215 20:64028692-64028714 GTGGGGGCTCAGGCTTCAGACGG + Intronic
1176302451 21:5105008-5105030 CTGAGGCCCCATGGCTCATAAGG - Intergenic
1176510735 21:7745578-7745600 CTGGAAGCCCAGGCCTCGGAGGG - Intronic
1176868575 21:14070445-14070467 CCGTGGGCCCAGGGCCCTGAGGG + Intergenic
1177107004 21:16969332-16969354 CTGGGGGCACTGGGGGCAGAGGG + Intergenic
1177134584 21:17296056-17296078 TTGAGGGCCCAGGGCCCAGATGG + Intergenic
1178644848 21:34376107-34376129 CTGGAAGCCCAGGCCTCGGAGGG - Intronic
1179854576 21:44156915-44156937 CTGAGGCCCCATGGCTCATAAGG + Intergenic
1179928769 21:44552788-44552810 CTGGAGGCCCCAGGTTCAGATGG - Intronic
1179934787 21:44595570-44595592 CTGGGTGTCCGGAGCTCAGAAGG - Intronic
1180010099 21:45043743-45043765 CTGGGCCCCCAGGTCTCGGAGGG - Intergenic
1180080845 21:45486947-45486969 CTGGGGGCCCAGGGGGCCCAGGG - Exonic
1180180992 21:46118621-46118643 CTGGCCGCCCAGGACGCAGAGGG + Exonic
1180468271 22:15635964-15635986 CTGGGGGCCCAGGGCAGGCAGGG - Intergenic
1180765583 22:18344434-18344456 GAGGGGGCACAGGTCTCAGAAGG - Intergenic
1180780733 22:18517958-18517980 GAGGGGGCACAGGTCTCAGAAGG + Intronic
1180813446 22:18775265-18775287 GAGGGGGCACAGGTCTCAGAAGG + Intergenic
1180955209 22:19738394-19738416 CTGCGTGCCCAGGTCACAGACGG + Intergenic
1181199628 22:21209595-21209617 GAGGGGGCACAGGTCTCAGAAGG + Intronic
1181404462 22:22672939-22672961 CTTAAGGCTCAGGGCTCAGATGG + Intergenic
1181413055 22:22738503-22738525 CTTAAGGCTCAGGGCTCAGATGG + Intronic
1181629635 22:24143822-24143844 CTGATGGCCCAGGGGGCAGAGGG - Intronic
1181702104 22:24627361-24627383 GAGGGGGCACAGGTCTCAGAAGG - Intronic
1181751546 22:24992317-24992339 CTGGGGGACAGGGTCTCAGATGG + Intronic
1182303026 22:29349384-29349406 CTGGGAGACCAGGGCACAGTTGG + Intronic
1182453545 22:30435279-30435301 ATGGGGGCCCAGGGAGGAGAGGG - Intergenic
1183382155 22:37495703-37495725 CCTGGGAGCCAGGGCTCAGATGG - Intronic
1183670786 22:39271277-39271299 CTGGAGGCCCAGGTCTCGGCAGG + Intergenic
1183688385 22:39374922-39374944 CTGGGTGCCCAGTGCACAGCAGG + Intronic
1183983335 22:41555429-41555451 CTGGAGGCCTATGGCCCAGAGGG + Intergenic
1184041969 22:41949663-41949685 CTGGGGACCCTGGTCCCAGAGGG + Intergenic
1184119325 22:42440114-42440136 CTGGTGGCCCAGTGCCCAGAAGG - Intergenic
1184712978 22:46263682-46263704 CTGGGCGCCCAGGGATCTCACGG - Intergenic
1185043499 22:48517619-48517641 CTGGTGGCCCAGGGCCCGGCGGG - Intronic
1185049264 22:48545288-48545310 CTGGTGGCCCCTGCCTCAGAGGG + Intronic
1185213547 22:49585832-49585854 CTCAGGGCCCAGGGGTGAGAGGG + Intronic
1185329176 22:50244463-50244485 CCGGGGGCCCGGAGCTGAGAAGG - Exonic
1185347672 22:50317540-50317562 CAGGAGGTCCTGGGCTCAGAAGG + Intronic
1203227205 22_KI270731v1_random:85324-85346 GAGGGGGCACAGGTCTCAGAAGG - Intergenic
1203263547 22_KI270734v1_random:947-969 GAGGGGGCACAGGTCTCAGAAGG + Intergenic
949419806 3:3853664-3853686 CTGAGGCCCCAGGGCTTGGAAGG - Intronic
949474675 3:4432059-4432081 CTAGGTTCCCAGGGATCAGATGG + Intronic
949754298 3:7391896-7391918 CTGGGGAGCCTGGGCTAAGATGG - Intronic
950459973 3:13115386-13115408 ATGGGGGCCCAGACCCCAGAGGG - Intergenic
950577047 3:13838218-13838240 GTGGAGACCCAGGGCCCAGAGGG + Intronic
950934392 3:16823938-16823960 CTGGTGGCCCAGGCCTCTCAGGG + Intronic
951168222 3:19507410-19507432 GTGGGGGGCCTGGGCTCACAGGG + Intronic
952834882 3:37594132-37594154 CTGCTGACCCAGAGCTCAGATGG - Intronic
953032205 3:39186298-39186320 CTGGGGCCCCAGGCCCCGGAGGG + Exonic
953990279 3:47478052-47478074 CAGTGGGCCCAGGGCTCAGGAGG - Intergenic
954130896 3:48560398-48560420 CCCTGGGCCCAGGGCTCACAAGG + Intronic
954376273 3:50195620-50195642 CTGGGGGCCCACGACTCACCTGG + Exonic
954377366 3:50202203-50202225 CTGGGGGCCCAGGCCGGGGAAGG + Intergenic
954438312 3:50507804-50507826 CTGGGTAAACAGGGCTCAGAAGG - Intergenic
955339260 3:58112333-58112355 CTGGGGGCCAGGGGAGCAGAGGG - Intronic
955449207 3:59049637-59049659 CAGGGGGCCCAGGGCTTGGGGGG + Intronic
955879310 3:63526874-63526896 CTGTGTGCTCAGAGCTCAGATGG + Intronic
960944822 3:122958668-122958690 CTGGGGGACTGGGGCCCAGAGGG + Intronic
961107867 3:124257672-124257694 CAGGGGACCCATGGCCCAGATGG + Intronic
961158309 3:124700041-124700063 CTGGGGGGCCAGGGCTGGGCTGG - Intronic
961410818 3:126719113-126719135 CTGGTTGGCCAGGGCTCATACGG + Intronic
961467254 3:127089379-127089401 CTGGGGACCCAGGTTCCAGAGGG - Intergenic
961663485 3:128482694-128482716 CTGAGGGACTAGGACTCAGAGGG - Intronic
962025843 3:131546750-131546772 CTGGGGTACCAGGACTCACATGG - Intronic
962238366 3:133729091-133729113 CTTGGGGGTCAGGGGTCAGAGGG + Intergenic
962876485 3:139539427-139539449 CGGGGCGCCCAGGGCGCAGCGGG + Intronic
963077434 3:141360229-141360251 GTGGGGTCCCAGAGCTAAGATGG - Intronic
965439255 3:168692280-168692302 CTGGGGGCCCTGAACTTAGAAGG - Intergenic
967776549 3:193391916-193391938 CAGGTGGCCCAGGGCACAGTGGG - Intergenic
968558145 4:1260942-1260964 CTGGGGTCCCAGGCCACAAATGG - Intergenic
968737503 4:2304931-2304953 CTCGAGGCCGAGGGCACAGATGG - Exonic
968745938 4:2360087-2360109 CTAGGGGCCATGGGCTCTGACGG + Intronic
968921389 4:3523942-3523964 CCGGGGGCCCAGGTCACACAGGG + Intronic
969621708 4:8281973-8281995 CTGTAGCCCCAGGGCTCGGAGGG + Intronic
969704857 4:8786149-8786171 CTGGGCTCCCAGGGCTCTGCTGG - Intergenic
971040250 4:22743861-22743883 ATGGGGGCCCAGGGGTGGGATGG + Intergenic
974013370 4:56627115-56627137 CTGGAGCCCCAGGGCCCAGGTGG + Intergenic
978619853 4:110627342-110627364 CTGGGGGAACAGTGTTCAGATGG + Intronic
979351170 4:119646089-119646111 CTGGGGGCCCCTGCCCCAGAAGG + Intergenic
980430196 4:132684141-132684163 CAGGGGGCCCTGGACTCAGAAGG + Intergenic
982044615 4:151431279-151431301 GTGGCGGGCCAGGGCTCACAAGG - Intronic
985626246 5:990059-990081 CAGGGGGCCCAGGCCAAAGAGGG - Intergenic
985671488 5:1209115-1209137 CTGGCAGCCCAGGGCCCAGGAGG + Intronic
985676737 5:1235330-1235352 TTTTGGGCCCAGGGCTGAGATGG - Intronic
985680766 5:1254475-1254497 CTGGGGGCCAAGGGCGCCGCCGG - Exonic
985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG + Intergenic
985927329 5:3028411-3028433 CTGGGGGCAGGGGGCACAGAGGG - Intergenic
986101085 5:4612508-4612530 CTGGGGGCCCCAGGCTTTGAGGG - Intergenic
986125805 5:4881563-4881585 CTGGGGCTGCAGGGCTCAGCTGG - Intergenic
986709485 5:10478279-10478301 CTGGGAGCCAGAGGCTCAGAAGG - Intergenic
987301948 5:16605294-16605316 CTGGGGACCCAGGGGAAAGATGG - Intronic
987644300 5:20648783-20648805 CAGGGGTTCCAGGGCTCACAGGG - Intergenic
992539209 5:77745181-77745203 CTGGGGGCACAAGGCAGAGAAGG + Intronic
993614842 5:90098088-90098110 CTGGGTCCCCTGGGCTCAGGTGG - Intergenic
994182365 5:96781798-96781820 GTGGGGGCCCAGAGCACAGAAGG - Exonic
996685894 5:126280305-126280327 CTTGGGGCCCTGTGCTCAGAAGG - Intergenic
997077453 5:130697310-130697332 CTGGGGGCACAGGCTTCAGGTGG - Intergenic
997119884 5:131163372-131163394 CTGAGGGCAGAGAGCTCAGAAGG - Intronic
997418855 5:133750455-133750477 CTGGGGGGCCTGGGCTGTGATGG - Intergenic
997736856 5:136219259-136219281 CTGTAGACCTAGGGCTCAGAGGG + Intronic
997975770 5:138440520-138440542 CTGGGGCCCTAGGGAACAGAGGG - Intronic
998139692 5:139692939-139692961 CTGGGGGTCCAAGACTCAGGAGG + Intergenic
998267459 5:140676942-140676964 CTGAAGCCCCAGAGCTCAGAAGG + Intronic
998503350 5:142652647-142652669 GTGTGGGCCCAGGGCTGAGATGG - Intronic
1000352021 5:160359713-160359735 GTGGGGACCCAGGGCCCAGGAGG - Intronic
1001306689 5:170579776-170579798 CTGCTGGGCCAGGGCTTAGAGGG + Intronic
1002107594 5:176887769-176887791 CTGGGGGTCCAGGGCCAAGCCGG - Intronic
1002108243 5:176890973-176890995 CTGGGTGGCTAGGGCTCAGATGG - Intronic
1002442745 5:179272852-179272874 CTGGGGACCAGGGCCTCAGAGGG + Intronic
1002879417 6:1238154-1238176 CTGTGGGCCCAGGGGCCAGGTGG + Intergenic
1003564189 6:7208556-7208578 CTGGGGCTCCGGGGCTCAGTGGG + Intronic
1005923249 6:30418668-30418690 CTGGCTGCTCAGGGCTCGGAGGG + Intergenic
1006021433 6:31120304-31120326 CTGGGGGCCCTGGGAACAGGAGG - Intronic
1006375320 6:33668631-33668653 CAGGGGGCACAGGGCTCACTCGG - Exonic
1007582204 6:42966303-42966325 CAGGGGGCCCATGGAGCAGAAGG + Exonic
1007718208 6:43869569-43869591 CTAGTGGCCCGGGGCTCCGAGGG + Intergenic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1010379601 6:75209065-75209087 CCGGGAGCCCAGGACTCAGAGGG - Intergenic
1013270093 6:108537393-108537415 CAGGGTGCCCTGGGATCAGAAGG + Intergenic
1016914063 6:149228399-149228421 CTGGTGGCCGAGGGTTCTGACGG - Intronic
1018465688 6:164042598-164042620 CTTTGGGCCCAGGCCTCAGCAGG - Intergenic
1018702059 6:166434974-166434996 CTGGGGGCCCATGGGTGGGAGGG + Intronic
1018905095 6:168071445-168071467 CTGGGGCCACAGGGCTCTGCTGG + Intronic
1018984458 6:168625707-168625729 CCTGGGGCCCAGGGCTCACACGG - Intronic
1019135876 6:169907494-169907516 CCAGGGGCACAGGGCTCAGGGGG + Intergenic
1019179558 6:170177805-170177827 CTCGGGGCTCAGGCCTCAGCTGG + Intergenic
1019215224 6:170438932-170438954 CTGAGGGCCTAGGGGTCAGCAGG + Intergenic
1019256770 7:57366-57388 CTGGGGGCCCAGGGCAGAGGTGG + Intergenic
1019261407 7:83993-84015 CCGGGGCTCCAGGGCTCTGAAGG + Intergenic
1019275543 7:173650-173672 CATGGGGCCCGGGGCTCTGAGGG + Intergenic
1019290146 7:246259-246281 CTGGGTGCCCAGGGTCCCGAAGG + Intronic
1019295145 7:269919-269941 CTGGGCTCCCCGGGCTAAGACGG - Intergenic
1019321203 7:416122-416144 CTGGGGCCCCGAGGCTGAGAGGG + Intergenic
1019470533 7:1218048-1218070 CTGAGTGCCCAGGGGTCAGAGGG - Intergenic
1019567047 7:1689355-1689377 CTGAGGGCTCAGAGCTCAGATGG + Intronic
1019744667 7:2692900-2692922 CTGGGGGCTCAGGGGACAGCCGG - Intronic
1020029902 7:4925415-4925437 TGGGGGGCTCAGGGCTGAGATGG - Intronic
1020261189 7:6531534-6531556 CTGGGCCTCCAGGGCTCAGCAGG + Intronic
1020546931 7:9544000-9544022 GTTGGGTCCCAGGGGTCAGATGG - Intergenic
1021845364 7:24757657-24757679 CTGACGGCCCAGCGCTCAGCCGG + Intronic
1022218367 7:28287788-28287810 CACAGGGCCCTGGGCTCAGAGGG - Intergenic
1022478524 7:30727736-30727758 GTGGGGGGCCAGGGGTCAGCAGG + Intronic
1023230714 7:38025216-38025238 CTGGGGGCCCAGCTCTGGGAGGG - Intronic
1023816342 7:43953119-43953141 CTGGGTGCCCAGGGCAGAGCAGG + Exonic
1023965482 7:44961468-44961490 CTGGGGGCTGAGGGCTGAGGGGG + Intergenic
1024700802 7:51902067-51902089 GTGGAGGCCCAGGGCCCAGGTGG - Intergenic
1026503020 7:70958981-70959003 CTGGAGGCCCAGGGCTGGCAAGG + Intergenic
1027052026 7:75026570-75026592 GTGGGCTTCCAGGGCTCAGAGGG - Intergenic
1029112795 7:98222295-98222317 CTGGGGGACCCTGGCCCAGAGGG + Intronic
1029453650 7:100656251-100656273 CGGGGTGCCCAGAGCTCGGATGG + Intronic
1031989655 7:128189387-128189409 CTGGAGGCACAGGGCCCAGGAGG + Intergenic
1032018847 7:128395522-128395544 CTGGGGGCATTGGGCTCTGAAGG - Intronic
1032389405 7:131546255-131546277 CTGGGATCCCAGGGCTAGGAGGG + Intronic
1032437329 7:131910856-131910878 CTGGGGGGCCGGGGCTAAGGAGG - Intergenic
1033557305 7:142500058-142500080 CCCGGGGCCCATGGCACAGAGGG - Intergenic
1033732784 7:144195500-144195522 CCGGGAGCCCAGGGCCGAGACGG + Intronic
1033743635 7:144294080-144294102 CCGGGAGCCCAGGGCCGAGACGG + Intergenic
1033750267 7:144355517-144355539 CCGGGAGCCCAGGGCCGAGACGG - Intronic
1034238554 7:149591912-149591934 CCGGTGGGCCTGGGCTCAGAGGG + Intergenic
1034241971 7:149617668-149617690 CTGGTGGGCCTGGGCTCAGATGG + Intergenic
1034270622 7:149802008-149802030 CATGGGGGCCGGGGCTCAGAGGG - Intergenic
1034345601 7:150383671-150383693 CTGGGACCTCAGGGCTGAGAAGG + Intronic
1034386239 7:150743491-150743513 CTGGTGGCTCAGGGCTCAGGGGG - Exonic
1034490279 7:151389591-151389613 GTGGGGGCCCAGGACTCTTAAGG + Intronic
1034763532 7:153696151-153696173 CTGCGGGCCCAGGCCCCAGGTGG - Intergenic
1035044412 7:155954297-155954319 CTGGTGGCCAAGGGCCCTGAGGG + Intergenic
1035228369 7:157445841-157445863 CTGGGGACTCAGGCCTCAGCAGG - Intergenic
1039211742 8:35224451-35224473 CTTGGGGCCCTGGGTTTAGATGG - Intergenic
1040888475 8:52290659-52290681 CTGGATGCGCAGGGCTCAGAAGG - Intronic
1041690355 8:60680311-60680333 CTGGGGGCGCGGGGCTCGGGCGG + Intronic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1048971404 8:139647016-139647038 CTGGGAGCCCAGTGCCCAGATGG - Intronic
1048984560 8:139728286-139728308 CTGAGGGACCAAGGATCAGAAGG + Intergenic
1049178002 8:141206013-141206035 GTGGAGGCCCAGGGCGCGGAGGG - Intergenic
1049218481 8:141418238-141418260 CTGGAGGCCCGGGGCTCAGCGGG - Intronic
1049220048 8:141424991-141425013 CTGGGGCTGCAGGGCTCAGGGGG - Intronic
1049369905 8:142259380-142259402 CTGGGGTCCCAGGCCTGAGAGGG + Intronic
1049441644 8:142612382-142612404 CTGGGGGCCCAAGCCTCAGTGGG + Intronic
1049753477 8:144296944-144296966 GGAGGGGCCCAGGGCACAGAAGG + Intronic
1049756086 8:144311886-144311908 CTGTGGGCCCAGGGCAGAGTTGG + Intronic
1049756890 8:144314779-144314801 GGAGGGGCCCAGGGCACAGAAGG + Exonic
1049773156 8:144393020-144393042 CTGGGGGCACGAGGCTCAGGTGG - Exonic
1049853963 8:144850047-144850069 CCGGGGGCACAGCGCTCTGAGGG - Intronic
1053072385 9:35108873-35108895 CTTGGGGTCCAGGGCACAGATGG + Exonic
1053104660 9:35399378-35399400 CTGGGTGCCCTGGGCAGAGAGGG - Exonic
1053142055 9:35688628-35688650 CTGGGGCCCCAGGGCACAGCAGG + Intronic
1056269221 9:84930362-84930384 ATGTGGGCCCAGAGCTCAGTGGG + Intronic
1056284944 9:85078249-85078271 CTGGGGGAGCAGAGCTCATATGG + Intergenic
1056626705 9:88259605-88259627 CTCAGGGCCCAGCCCTCAGAAGG - Intergenic
1056679517 9:88704949-88704971 CTGGGGGCCCATGGGTGAGCTGG + Intergenic
1057230626 9:93319431-93319453 CTCGGGGCCCAGGCCACAGCTGG - Intronic
1057797968 9:98171823-98171845 CTGGGGGCGCAGTGCTGAGGAGG + Intronic
1057824644 9:98362897-98362919 CTGGGGGCCCAGGTCATAGGGGG + Intronic
1057904693 9:98974727-98974749 CTGGGGGGCCGGGGCTGAGGGGG - Intronic
1058638222 9:107057406-107057428 TTGGTGGGCCAGGCCTCAGAGGG + Intergenic
1059475814 9:114546821-114546843 CTGGGGATTCTGGGCTCAGAAGG + Intergenic
1060147820 9:121267834-121267856 CTGGGGCCAAAGAGCTCAGATGG - Intronic
1060207238 9:121689343-121689365 CTGGGAGTCCTGGCCTCAGAAGG - Intronic
1060553055 9:124494770-124494792 CTGGGGGCCAGGGGCTCAGAAGG + Intronic
1060925691 9:127453803-127453825 CTGTGGGCTCAGGACACAGATGG + Intronic
1061064136 9:128267056-128267078 TGGGGGGCCCAGGCCTCAGCTGG - Intronic
1061065729 9:128276381-128276403 CTCGGACCCCAGGGCTCAGGAGG + Exonic
1061209167 9:129180982-129181004 CTGTGGGACCAGGGCCCATAAGG + Intergenic
1061832478 9:133304566-133304588 ATGGGGGCCCAGGGCGCTGCAGG - Intergenic
1061846242 9:133389929-133389951 CTGGGGGTCAAAGGCTCAGCAGG - Intronic
1061884748 9:133585821-133585843 CTGGGGGCCCAGGGCAGAGCTGG + Intronic
1061908515 9:133710999-133711021 CTGGGAGCCAAGGGCACAGGTGG - Intronic
1062227823 9:135463483-135463505 CAGGGAGCTCAGGGCTCAGGCGG + Intergenic
1062253366 9:135609173-135609195 CTGGGGGCTCAGGGCTTGGGGGG - Intergenic
1062278959 9:135743564-135743586 CTGGGGCCCCATGGTGCAGAGGG + Intronic
1062303342 9:135888142-135888164 GTAGGGGGCCAGGGTTCAGAGGG - Intronic
1062446695 9:136598240-136598262 CTGGGGGCCCAGGGCAGAGACGG + Intergenic
1062450561 9:136614092-136614114 CTGGGGTCCCACAGCTCCGAGGG - Intergenic
1062538831 9:137032540-137032562 CTGGGAGACCAGGGCCCAGCTGG - Exonic
1062583308 9:137237700-137237722 CTGGGGGCCAAGGGCACAGAGGG - Intergenic
1185448557 X:271226-271248 CTGGCCGCCCAGGACACAGAGGG + Intergenic
1185463998 X:344687-344709 TTAGGGGCCCAGGGCGCAGGTGG + Intronic
1185515913 X:698955-698977 GTGGGGGCCCAGTGGTAAGAAGG + Intergenic
1189325317 X:40108011-40108033 CTGGGGGCCCAGGCCGCCGAAGG - Intronic
1190212703 X:48460623-48460645 CGTGGGGCCCACGGCTGAGAGGG - Intronic
1190335318 X:49258378-49258400 CTGGGGGCCCGGGGCCCAGGGGG - Exonic
1195618836 X:106933505-106933527 CCGTGGGCCCAGGGCTGAGTGGG - Intronic
1195626647 X:107010430-107010452 CTGGGTGCGCAGTGTTCAGAGGG + Intergenic
1195657624 X:107347486-107347508 CTGGGGGCCCAATGCTCAGAAGG + Intergenic
1196785680 X:119419610-119419632 ATGTGGGACCATGGCTCAGAAGG - Intronic
1196820373 X:119695734-119695756 CTGGAGGCCCAGGCCCCAGGAGG - Intergenic
1197127115 X:122959677-122959699 CTGGGGGCTGGGGGCTCTGAGGG - Intergenic
1198750658 X:139933417-139933439 CTGGGGGCCGAGGGTGTAGAGGG - Intronic
1199608535 X:149595038-149595060 CTGTGGGCCCATGACTCAGACGG - Intergenic
1199630587 X:149774322-149774344 CTGTGGGCCCATGACTCAGACGG + Exonic
1199760768 X:150902459-150902481 TTTGGGTCCCAGGGCACAGAAGG - Intergenic
1199983346 X:152933227-152933249 CTGGAGGCCCAGCCCTCACATGG + Intronic
1200063977 X:153496081-153496103 CAGGGGGCCCAGGGATCTGCAGG + Intronic