ID: 1078846433

View in Genome Browser
Species Human (GRCh38)
Location 11:15122970-15122992
Sequence GAGATGTAGGAGAGGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 419}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078846433_1078846446 18 Left 1078846433 11:15122970-15122992 CCTGCTGCCCTCTCCTACATCTC 0: 1
1: 0
2: 3
3: 35
4: 419
Right 1078846446 11:15123011-15123033 CCTGGCTCTCCCTGCCACACTGG 0: 1
1: 0
2: 3
3: 48
4: 412
1078846433_1078846439 0 Left 1078846433 11:15122970-15122992 CCTGCTGCCCTCTCCTACATCTC 0: 1
1: 0
2: 3
3: 35
4: 419
Right 1078846439 11:15122993-15123015 CCTACCCAGCACTCCCTCCCTGG 0: 1
1: 0
2: 3
3: 37
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078846433 Original CRISPR GAGATGTAGGAGAGGGCAGC AGG (reversed) Intronic
901167300 1:7229644-7229666 GAGAAGGAGGAGAGGGGAGGAGG + Intronic
902257387 1:15198807-15198829 GAGAAGGAGGAAAGAGCAGCAGG + Intronic
903136484 1:21312692-21312714 GAGAGGTAGGAGGATGCAGCAGG + Intronic
903221279 1:21870921-21870943 GAATTGCAGGACAGGGCAGCAGG + Intronic
903277809 1:22232930-22232952 GAGGGGGAGGAGAGGGCTGCAGG - Intergenic
903578783 1:24355707-24355729 GAGCTGTAGGAGCTGGCTGCAGG - Intronic
903588803 1:24438531-24438553 GCGATCTAGGAGAGGGCAGGGGG + Intronic
903928807 1:26850441-26850463 GAGTTGTGGGTGAGGGCAGTGGG + Intronic
904233374 1:29096341-29096363 GAGAAGGAGGAGGGGGCAGCTGG + Intronic
904302001 1:29560234-29560256 GAGATGGAGGACAGGGCACCAGG - Intergenic
904455344 1:30644460-30644482 GAGATGGAGGACAGGGCACCGGG + Intergenic
904745646 1:32709099-32709121 GAGAGGCACCAGAGGGCAGCAGG + Intergenic
904998581 1:34650539-34650561 AAGCTGTAGAAGAGGGCGGCAGG - Intergenic
905388504 1:37621201-37621223 GGGAAGTTGGAGAGGGAAGCAGG + Intronic
905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG + Intergenic
905865262 1:41373034-41373056 GAGCTGCAGGAGAAAGCAGCAGG + Intronic
905893503 1:41531237-41531259 GAGATGGAGGACAGGGGAGATGG + Intronic
905893511 1:41531269-41531291 GAGATGGAGGACAGGGGAGATGG + Intronic
905893543 1:41531413-41531435 GAGATGGAGGACAGGGGAGATGG + Intronic
905893567 1:41531525-41531547 GAGATGGAGGACAGGGGAGATGG + Intronic
905893582 1:41531589-41531611 GAGATGGAGGACAGGGGAGATGG + Intronic
905893596 1:41531651-41531673 GAGATGGAGGACAGGGGAGACGG + Intronic
905893616 1:41531747-41531769 GAGATGGAGGACAGGGGAGATGG + Intronic
905893631 1:41531811-41531833 GAGATGGAGGACAGGGGAGATGG + Intronic
905893645 1:41531873-41531895 GAGATGGAGGACAGGGGAGATGG + Intronic
905893650 1:41531889-41531911 GAGATGGAGGACAGGGGAGATGG + Intronic
905893671 1:41531985-41532007 GAGATGGAGGACAGGGGAGATGG + Intronic
905893685 1:41532049-41532071 GAGATGGAGGACAGGGGAGATGG + Intronic
905893698 1:41532111-41532133 GAGATGGAGGACAGGGGAGATGG + Intronic
905893720 1:41532221-41532243 GAGATGGAGGACAGGGGAGATGG + Intronic
906209710 1:44005820-44005842 GATCTCCAGGAGAGGGCAGCAGG + Intronic
906258448 1:44368123-44368145 CAGAAGAAAGAGAGGGCAGCTGG + Intergenic
906749055 1:48242532-48242554 GAGATATCCGAGAGGCCAGCCGG + Exonic
907289896 1:53407059-53407081 GAGAATTAGGAGAGGGCCGAGGG + Intergenic
907298374 1:53470103-53470125 GAGAGGCTGGAGAGGCCAGCAGG - Intergenic
907797682 1:57733792-57733814 GAGATGGGGGAGATGGCAGAGGG + Intronic
908441780 1:64162412-64162434 GAGAGGTAGGACAGTGCAGTTGG + Intronic
908571868 1:65419897-65419919 GAGAGGCAGGAGAGGGAAGGAGG - Intergenic
908581990 1:65525825-65525847 GGGGTGTCGGAGAGGGAAGCAGG - Intronic
908928737 1:69289795-69289817 GAGATGTAGGAGAGAATAACAGG + Intergenic
909533330 1:76706089-76706111 GAGATGGAGGAGATGGCAAAGGG + Intergenic
910350695 1:86294274-86294296 GAAATGCAGGAGAGTGCAGTGGG - Intergenic
910679110 1:89844086-89844108 GAGAGGGTGGAGAGGGCAGCTGG - Intronic
915033663 1:152905144-152905166 AAGATGTAAGAGAGGAAAGCAGG + Intergenic
915266198 1:154719774-154719796 GTGATGAAAGAGAGGGCAGCCGG - Intronic
915572523 1:156752084-156752106 GAGATGGAGCAGAGGGCAGGCGG - Intronic
915613175 1:157012324-157012346 GGGATGAAGGAGTGGGGAGCAGG + Intronic
915640896 1:157225231-157225253 GTCATGTAGCAGAGGGCACCTGG - Intergenic
916412359 1:164559073-164559095 GAGAAGGAGGAGAGGGGAGGGGG - Intronic
917098634 1:171424451-171424473 GAGATGTATGAGAATGCTGCTGG + Intergenic
917160333 1:172050174-172050196 GAAGAGTAGGTGAGGGCAGCAGG - Intronic
919655485 1:200193202-200193224 GAGAGGAAGGAGAGGGCAACAGG + Intergenic
919773419 1:201177437-201177459 GATAGGGAGGAGAGGGCAGGAGG + Intergenic
919930230 1:202216624-202216646 GAGAGGTAGTAGAGAGCAGAGGG + Intronic
920084254 1:203403518-203403540 GAGATTTAGGATTGGGCAGGAGG + Intergenic
920298734 1:204975636-204975658 GAGGTGTAGGAGAGAGAAGCAGG - Intronic
920916924 1:210265251-210265273 GAGATCCAGGGGAGGACAGCAGG + Intergenic
923033381 1:230267405-230267427 AACATGGAGGTGAGGGCAGCCGG - Intronic
1063382260 10:5592844-5592866 GAGAGGGAGGAGAAGGGAGCTGG + Intergenic
1063470944 10:6284732-6284754 GAGATGGAGGAGAGGGAAATTGG - Intergenic
1064164076 10:12972004-12972026 GAGAGGCAGGAGAGAGCAGAGGG - Intronic
1064356553 10:14624102-14624124 GAGAGGCAGGTGAGGGAAGCTGG + Intronic
1064627848 10:17279761-17279783 GAGATGCAGGTGTTGGCAGCTGG + Intergenic
1066756326 10:38716406-38716428 GAAATGGAGGAGAGGGGAGGGGG - Intergenic
1067565288 10:47331737-47331759 GAGATGGAGGAGAGGCCAGTAGG + Intergenic
1067807600 10:49404078-49404100 GAGGTGTTGGGGAGGGCAGAGGG - Intergenic
1068631469 10:59303057-59303079 GAGTGGTAGGAGAGGGGACCAGG - Intronic
1069718322 10:70534607-70534629 GAGAGGTAGGGGAGGGTATCGGG - Intronic
1070041085 10:72780683-72780705 GAAGGTTAGGAGAGGGCAGCAGG - Intronic
1070668645 10:78362865-78362887 GAGATGAAGCAGAGGGCAGTTGG + Intergenic
1070732193 10:78838197-78838219 CAGATCTAGGAAAGGGCAACAGG + Intergenic
1071196493 10:83166693-83166715 GAGTTAAAGGAGAGGGCAGATGG - Intergenic
1071437289 10:85659274-85659296 AAGATGGAGGAGAGTGCTGCTGG + Intronic
1071472445 10:85993223-85993245 GGGATGTGGGAGAGGACAGTGGG + Intronic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071565696 10:86670330-86670352 GAGCTGTGGGAAAGGGCAGTGGG - Intronic
1071567780 10:86680584-86680606 GAGATCTGGGTGAGGCCAGCAGG - Intronic
1073156815 10:101354062-101354084 GAGAGGTAAGAGAGGGCGGGGGG + Exonic
1073297368 10:102449435-102449457 GAGATGGTGAAGAGGGCAGCTGG + Intergenic
1074112037 10:110429591-110429613 ATGACGCAGGAGAGGGCAGCTGG - Intergenic
1074285907 10:112098143-112098165 GATATCTAGAAGAGGGCTGCTGG - Intergenic
1074385324 10:113012336-113012358 GAAACGTAGGAGAGTGGAGCAGG + Intronic
1074526216 10:114265574-114265596 GAGAGGTGGGAAAGGACAGCTGG - Intronic
1075400327 10:122156660-122156682 AAGCTGTAAGAAAGGGCAGCTGG - Intronic
1076499747 10:130928364-130928386 GAGCTGTAGGAGAGAGAGGCTGG + Intergenic
1077207107 11:1349985-1350007 GGCAGGTAGGGGAGGGCAGCAGG - Intergenic
1077222709 11:1424616-1424638 CAGATGGAGGGCAGGGCAGCAGG - Intronic
1077288570 11:1778444-1778466 GGGAGGTAGGCGAGGGCTGCAGG - Intergenic
1077392576 11:2306922-2306944 GAGATGGAGGAGGGGGAAGGAGG + Intronic
1077484274 11:2831725-2831747 GAGAGGCAGAGGAGGGCAGCGGG - Intronic
1078846433 11:15122970-15122992 GAGATGTAGGAGAGGGCAGCAGG - Intronic
1080922927 11:36726732-36726754 GAGCTGTAGCAGGGGGCAGCTGG + Intergenic
1081752089 11:45518556-45518578 GAGATGGGGGAGAGGGCAGGAGG - Intergenic
1082996148 11:59257136-59257158 GAGATGGCAGGGAGGGCAGCTGG - Intergenic
1083035876 11:59636986-59637008 GAGATGGAGAACAGGACAGCTGG + Exonic
1083228498 11:61300068-61300090 GAGAGGAGGGGGAGGGCAGCAGG + Exonic
1084662594 11:70555172-70555194 GAGATGGAGGAGTGGACAGTCGG - Intronic
1089002025 11:115060018-115060040 GAGATGATGGAGAGGGTACCAGG + Intergenic
1090773442 11:129943126-129943148 GAGAACTAGGAAAGGGCAGTGGG - Intronic
1091304002 11:134525182-134525204 GTGATGTCAGAGAGTGCAGCAGG + Intergenic
1091600057 12:1912570-1912592 GAGAAGGAGGAGAGGGGAGGGGG + Intronic
1092051081 12:5470648-5470670 GAGATCTGGGAGAAGGCAGGGGG - Intronic
1092377346 12:7966921-7966943 GAGAGGTGGCAGAGGGCAGGGGG + Intergenic
1093106455 12:15093398-15093420 GAGATGTATTACATGGCAGCAGG - Intergenic
1094059794 12:26301577-26301599 GCGATGAAGGAGAGGGGAGTGGG - Intergenic
1094132645 12:27091104-27091126 GAGAGCTAGGAGAGGACTGCAGG - Intergenic
1096199991 12:49674575-49674597 CAGATGTCTAAGAGGGCAGCTGG - Intronic
1096626887 12:52901364-52901386 GTGAGGGTGGAGAGGGCAGCTGG - Intronic
1097196286 12:57243952-57243974 AAAAGGTAGGAGAGGACAGCAGG + Intronic
1098337143 12:69415798-69415820 AAGATGTCTGAGAGGGCAGTGGG + Intergenic
1099779049 12:87171241-87171263 GAGAAGGAGGAGAGGGGAGGAGG + Intergenic
1102063368 12:109952305-109952327 GAGCTGGGGGAGAGGGCAGCAGG - Intronic
1102205593 12:111088830-111088852 GAGATGTCCGACCGGGCAGCTGG + Intronic
1102788638 12:115624756-115624778 AAGATGTAGGAGAGCCTAGCTGG + Intergenic
1102803311 12:115756544-115756566 TAGAAGTTGCAGAGGGCAGCGGG - Intergenic
1102867175 12:116383513-116383535 AGGGTGTAGGAGAGGGCAGAGGG + Intergenic
1103618640 12:122171949-122171971 GAGTTGTGGCAGAGGGCAGATGG - Intronic
1104516415 12:129431278-129431300 GAGATGTAGCACATGGCAGTGGG - Intronic
1104774654 12:131384209-131384231 GTGGTATAGGAGAGGGCGGCAGG - Intergenic
1105814387 13:24021165-24021187 GAGAGGCAGGAGAGAGGAGCTGG + Intronic
1107262783 13:38515104-38515126 GAGTGGTAGGAGAGAGCATCAGG - Intergenic
1107711700 13:43156954-43156976 GAGACAGAGGAGAGGTCAGCTGG - Intergenic
1110171622 13:72507566-72507588 GAGAAGTAGGAGTGGGAAGCTGG - Intergenic
1111085361 13:83369983-83370005 GAGAAGTTGGAGAGGAAAGCAGG - Intergenic
1111654203 13:91131988-91132010 GGGAAGCAGGAGAGGGAAGCAGG + Intergenic
1111843144 13:93473987-93474009 GAGATGTGAGTGATGGCAGCAGG - Intronic
1112274712 13:98005643-98005665 CAGATGCAAGAGAAGGCAGCAGG + Intronic
1113079294 13:106500483-106500505 AGGATGGAGGAGAGGGCAGATGG + Intronic
1114828096 14:26105843-26105865 GCGATCTAGCAGAGGCCAGCTGG + Intergenic
1115691476 14:35848616-35848638 GAAATGTGGGAGTGGGCAGTGGG - Intronic
1116239955 14:42328016-42328038 GAGATGTTGGAGAAGGGAGTTGG - Intergenic
1118941811 14:70346031-70346053 AAGCTTTAGGAGAGGGCAGTGGG - Intronic
1118974554 14:70665449-70665471 GAGAGGGAGGAGAGGGGAGGGGG + Intronic
1119590577 14:75883822-75883844 GAGTAGTAGGAAAGGGCAGTAGG + Intronic
1122047194 14:99032565-99032587 GAGAGATAGGAGAGGAAAGCTGG + Intergenic
1122108247 14:99476996-99477018 GGGAAGTAGGGGAGGGCAGAGGG - Intronic
1122290170 14:100676523-100676545 GAGATGCAGGTGAGTGCTGCAGG - Intergenic
1124351332 15:28957727-28957749 GGGCTGTAGGAGAGGGCGACGGG + Intronic
1124649104 15:31462006-31462028 GTGATGGAGGAGGGGGCAGAGGG - Intergenic
1125503000 15:40251206-40251228 GGGATGTTGGGGATGGCAGCAGG + Exonic
1128084323 15:64875504-64875526 GTGAGGTGGGAGAGGGGAGCGGG + Intronic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128293536 15:66497614-66497636 GAGGGGCAGGAGAGGGCCGCGGG + Intronic
1128382640 15:67124796-67124818 AAGATGTGGCACAGGGCAGCCGG + Intronic
1129166851 15:73783376-73783398 GAGATGGAGGAGAGGGCAGAGGG - Intergenic
1129943927 15:79523049-79523071 GAGGTGTAAGAAAGAGCAGCCGG + Intergenic
1132183420 15:99780429-99780451 GAGATGGAGGAGAGGGAGGAGGG + Intergenic
1132387050 15:101408090-101408112 GGGATGCAGGACAGGACAGCAGG + Intronic
1132435015 15:101793052-101793074 GAGATGGAGGAGAGGGAGGAGGG - Intergenic
1133333982 16:4994855-4994877 GTGATTCAGGAGAGGGCAGAAGG - Intronic
1133569609 16:7027854-7027876 GAGAGGGAGGAGAGGGAAACCGG + Intronic
1133729639 16:8568695-8568717 GAGATGTAGGGGAGGGCCCGAGG - Intergenic
1134502708 16:14781606-14781628 GAGATGAAGGAGAAGTCAGCTGG - Intronic
1134577855 16:15347289-15347311 GCGATGAAGGAGAAGTCAGCTGG + Intergenic
1134650204 16:15902622-15902644 GAGATTTTGGAGAGGGTATCAGG - Intergenic
1134724733 16:16410257-16410279 GCGATGAAGGAGAAGTCAGCTGG - Intergenic
1134942698 16:18301602-18301624 GCGATGAAGGAGAAGTCAGCTGG + Intergenic
1135958897 16:26979513-26979535 GGGATGCAGGAGAGCTCAGCTGG - Intergenic
1136146588 16:28320003-28320025 GAGCTGGAGGGGAGGGCGGCGGG + Intronic
1137271272 16:46903880-46903902 GAGATCTCGGAGAGAGCTGCAGG + Intronic
1137441991 16:48505809-48505831 GAGAAGCGGGAGAGGGCAGAAGG + Intergenic
1137447306 16:48539691-48539713 GTGGTGGTGGAGAGGGCAGCTGG - Exonic
1137955290 16:52823419-52823441 GAGATGTAGGTGCTGGCAGCTGG - Intergenic
1138083787 16:54115679-54115701 GAGATGTAGGGCAGAGCAGACGG + Exonic
1138831227 16:60377207-60377229 GAGCTGTGTGAGAGGGCAGTTGG + Intergenic
1139168550 16:64601588-64601610 GAGATGGAGTAGAGGGCAAAGGG + Intergenic
1141202376 16:81908059-81908081 CAGCTGGAGGAGAGGGCAACAGG - Intronic
1141479089 16:84294536-84294558 GACATGCAGGGGAGTGCAGCCGG - Intergenic
1141877295 16:86834634-86834656 CAGATGGTGGAGAGGGCTGCAGG - Intergenic
1141884041 16:86879585-86879607 GAGATGGACGTGAGGGAAGCAGG - Intergenic
1142294524 16:89211633-89211655 GAGCTGCAGGGGAGGGGAGCAGG + Intergenic
1142470551 17:161125-161147 AAGAGGGAGGAGAGGGCAGGAGG - Intronic
1143100605 17:4502735-4502757 GGCATGAAGGAGAAGGCAGCTGG - Intronic
1143361865 17:6377533-6377555 GAGAGGGAGAAGAGGGCAGGGGG - Intergenic
1143403496 17:6660691-6660713 GAGATGAAGGAGAGGGGAAAGGG + Intergenic
1143473953 17:7192541-7192563 GAGGAGTGGGAGAGGGGAGCCGG + Intronic
1144055909 17:11540333-11540355 GAGATGGAGGAGAGTGAAGTTGG + Intronic
1144645493 17:16970923-16970945 GAGGTGTGGGACAGAGCAGCAGG + Intronic
1144646857 17:16981021-16981043 GAGAGGTGGGAGAGGAGAGCAGG - Intergenic
1145394545 17:22484900-22484922 GGGATGTAGGAGAGGGCACAAGG + Intergenic
1146229578 17:31095542-31095564 GAGGGGTAGGAGGGGACAGCTGG + Intronic
1147121417 17:38337479-38337501 GAGAGGCAGGAGAGGCAAGCAGG - Intronic
1147472005 17:40671385-40671407 GAAATATGGGAGAGAGCAGCTGG - Intergenic
1147621956 17:41873973-41873995 GAGATGGGGAAGAGGGAAGCAGG + Intronic
1147905876 17:43822790-43822812 GAGATGCAGGTGCTGGCAGCTGG - Intronic
1148048602 17:44758726-44758748 GATTTGTAGGGGAGGGAAGCAGG - Intergenic
1148595996 17:48855970-48855992 GAGATGGAGGAGAACGCAACTGG - Intronic
1148747688 17:49927645-49927667 GGGTTGGAGGAGGGGGCAGCTGG - Intergenic
1148834741 17:50460153-50460175 GGGATAAAGGAGAGGGCAGATGG - Intronic
1149087227 17:52732650-52732672 GAGAAGTAGTAGAGGACAACAGG - Intergenic
1150138535 17:62709584-62709606 TAGATGAAGGAGAGGGAAGGAGG + Intronic
1150742218 17:67788488-67788510 AAGATGTTCAAGAGGGCAGCTGG - Intergenic
1152007473 17:77691610-77691632 GAGATGGCAGGGAGGGCAGCTGG + Intergenic
1152878135 17:82800040-82800062 GAGATGGAGGAAGGGGCAGTGGG - Intronic
1153263661 18:3247432-3247454 GAAATCGAGGAGAGGGCTGCGGG - Intergenic
1153834128 18:8949246-8949268 GAGATTTCCGAGAAGGCAGCAGG + Intergenic
1154193840 18:12252057-12252079 GAGAGGTGGGAGAGGGCAGAGGG - Intergenic
1154217120 18:12423430-12423452 GAGAGGTAGCAGAGGCCACCTGG + Intronic
1155654564 18:28177979-28178001 GAGGAATAGGAGAGGGGAGCGGG - Intergenic
1156088243 18:33434835-33434857 TAGATGTAGGAGAAGGAAGAGGG + Intronic
1157110250 18:44813901-44813923 GAGTTGTAGGAGAGTGCTGGAGG + Intronic
1157559531 18:48636794-48636816 GAGAGGTGGGAGAGGGGAGGGGG + Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158223884 18:55180461-55180483 GAGATGTAGGACAGGGATTCAGG - Intergenic
1159563138 18:70017073-70017095 AAGATGCAGAAGAGGGGAGCTGG + Intronic
1159899697 18:74034492-74034514 GGAATCTAGGGGAGGGCAGCAGG + Intergenic
1160564909 18:79781008-79781030 GAGATGCAGGTGAGAGAAGCGGG - Intergenic
1160565139 18:79782433-79782455 GAGATGCTGGGGAGGGCTGCTGG - Intergenic
1161440958 19:4291410-4291432 CAGAAGTAGGGGAGGGGAGCTGG + Intergenic
1161554165 19:4931059-4931081 GAGACACAGGAGGGGGCAGCCGG - Intronic
1162038184 19:7953584-7953606 GAGAGGAAGGAGAGGGGAGGGGG - Intergenic
1163548537 19:17952671-17952693 GAGAGGGAGGAGGGGGCAACGGG - Intronic
1164404937 19:27936365-27936387 GAACTGTGGGATAGGGCAGCCGG + Intergenic
1164654488 19:29910502-29910524 GAGATGCAGGAGAGGGAGGGAGG - Intergenic
1164829778 19:31311539-31311561 GAGATGAAGCAGAGGACAGAAGG + Intronic
1165072407 19:33263254-33263276 GAGAGGGAGGGGAGGGCAGCGGG - Intergenic
1165462829 19:35954125-35954147 CAGAGGCAGGAGAGGGCACCAGG - Intergenic
1165714813 19:38037466-38037488 GAGAGGTAGGTGGGGGCAGATGG + Intronic
1166083283 19:40458339-40458361 GAGGTGTAGGGGAGGGCCGTGGG + Intronic
1166324165 19:42038987-42039009 GGGATGCAGGAGAGGACAGGAGG - Intronic
1166343626 19:42152405-42152427 GAGGTTTGGGGGAGGGCAGCCGG - Intronic
1166550388 19:43662087-43662109 CAGGTGGAGAAGAGGGCAGCAGG - Intronic
1167170247 19:47826156-47826178 GAGAAGTGGGAGAGGACAGAGGG + Intronic
1167250443 19:48396168-48396190 GAGATGGAGGCGGGGGGAGCGGG + Intronic
1167575678 19:50316368-50316390 CAGATGTAGGAGGGAGGAGCAGG + Intronic
925677365 2:6378184-6378206 CAGATGTAGGAGAGTGAAACTGG + Intergenic
925871817 2:8278250-8278272 GTGGTGCAGCAGAGGGCAGCTGG - Intergenic
925961940 2:9025926-9025948 GAGTTGTAGGATAGAGCAACCGG + Intergenic
926059158 2:9794463-9794485 GAGATGGGGGAGAGGGTGGCAGG - Intergenic
926228178 2:10983240-10983262 GGGAGGTGGGAGAGGGCTGCAGG - Intergenic
934319625 2:91960664-91960686 GAAATGGAGGAGAGGGGAGGGGG - Intergenic
934736942 2:96694298-96694320 GAGGTGAGGGTGAGGGCAGCAGG + Intergenic
934960789 2:98670913-98670935 GAGATGTTGGAGTAGGCAGTTGG - Intronic
935121474 2:100186848-100186870 CAGATGTAGGAAAGGTCAGAGGG - Intergenic
935370597 2:102342677-102342699 AAGATGTGGAAGAGGGCAGTTGG + Intronic
935718196 2:105957408-105957430 CAGATGTAGTGCAGGGCAGCTGG - Intergenic
937209891 2:120261670-120261692 GAGATGGAGGGGAAGGGAGCAGG + Intronic
937470686 2:122171712-122171734 GAGCTGTAGGGGAAGGCAGGAGG - Intergenic
937556722 2:123166912-123166934 AGGATGTAGAAGAGGGCAACAGG + Intergenic
937706552 2:124927391-124927413 GTGATGTAGTGGAGGTCAGCAGG + Intergenic
938291654 2:130153838-130153860 GAGAGGAAGGAGTGGCCAGCCGG + Exonic
938464897 2:131519125-131519147 GAGAGGAAGGAGTGGCCAGCCGG - Intergenic
938655757 2:133431532-133431554 AAGTTGTCGAAGAGGGCAGCTGG + Intronic
939039945 2:137176646-137176668 GAGATGTAGGTGATATCAGCTGG - Intronic
939341745 2:140905201-140905223 GCGGTGGAGGTGAGGGCAGCAGG - Intronic
942629631 2:177941647-177941669 GGGAGGAAGGAGAGGGCAGCTGG - Intronic
946200527 2:218068476-218068498 GGGACGGAGGAGAGGGCAGACGG + Intronic
946323426 2:218968174-218968196 GAGATGTGTGAGAGGGGAGTGGG - Intergenic
946601538 2:221365263-221365285 GAGATGCAGGAAAGTGAAGCAGG + Intergenic
946976915 2:225163533-225163555 GAGATTTGGGAGAAGGAAGCGGG - Intergenic
947357544 2:229312539-229312561 GACATGGAGAAGAGGACAGCAGG - Intergenic
947448537 2:230183484-230183506 GAGAAGAAGGAGAGGGCGGGTGG + Intronic
947704348 2:232262260-232262282 GAGATGTAGGTGAGGGGATCTGG - Intronic
947728133 2:232413071-232413093 GAGATGTTGCAGAAGGCAGTGGG - Intergenic
947817826 2:233049710-233049732 GAGGTGTGGGAGAGGGAACCAGG - Intergenic
947874210 2:233457780-233457802 GAGAGACAGGAGAGGGCTGCAGG + Intronic
948103652 2:235395319-235395341 AAGATGTAGGAGTGGAAAGCTGG - Intergenic
948384625 2:237573880-237573902 AGGAAGTAGGAGAGGGTAGCAGG - Intergenic
948494635 2:238339486-238339508 GCACTGCAGGAGAGGGCAGCAGG + Intronic
948756536 2:240162818-240162840 CAGCTGGAGGAGAAGGCAGCTGG - Intergenic
948787153 2:240358643-240358665 GAGCTGGAGGAGAGGGCCACAGG + Intergenic
948894467 2:240921845-240921867 GGGGTGGAGGGGAGGGCAGCAGG - Intronic
948920495 2:241063941-241063963 GGGAGGGAGGAGAGGACAGCGGG - Intronic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
1168787243 20:550581-550603 GAGATGTATGGAATGGCAGCTGG + Intergenic
1169442085 20:5641003-5641025 GAGATGCAGGAAAGAGCAGAAGG - Intergenic
1169780460 20:9303988-9304010 GAGATTTAGGTGGGGGCAGAAGG - Intronic
1171049126 20:21839208-21839230 ATGATGTTGGACAGGGCAGCAGG + Intergenic
1171389035 20:24789499-24789521 GAGCTGAAGCAGAGGGCAGGGGG - Intergenic
1172042978 20:32059043-32059065 GAGATGAAGGTGCCGGCAGCTGG + Intronic
1172353530 20:34262491-34262513 GAGATGAAGGAAGGGGCACCTGG + Intronic
1172531267 20:35632801-35632823 AGGATGTGGGAGGGGGCAGCTGG - Exonic
1172704906 20:36876018-36876040 GAGAGGGAGCAAAGGGCAGCTGG + Intergenic
1173161695 20:40657592-40657614 GAGATGCTGGACAGGGCTGCTGG + Intergenic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1175299056 20:57929950-57929972 GAGGGGTTGGAGAGGACAGCAGG + Intergenic
1175652283 20:60735839-60735861 GAGATCTGGGAGATGGCAGGAGG - Intergenic
1176249361 20:64112921-64112943 GAGATGTAGGAGAGGGCTGGAGG + Intergenic
1178127395 21:29529768-29529790 GGGGAGTAGGAAAGGGCAGCAGG + Intronic
1178457218 21:32766614-32766636 GAGAGGAAGTAGAGGGCAGCAGG - Intronic
1178579350 21:33824706-33824728 GAGCTGCAGGAGAGGTGAGCAGG - Intronic
1179408546 21:41144560-41144582 GATAAGTAGGGGAGGGCATCTGG + Intergenic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1179983458 21:44908246-44908268 GAGAAGAAGGGGAGGGCAGCAGG - Intronic
1180853498 22:19032970-19032992 GAGAGCAAGGTGAGGGCAGCTGG - Intergenic
1181130303 22:20727297-20727319 GAGAAGTAGGAGAGGCCTGTGGG + Exonic
1181319120 22:21991160-21991182 CAGAAGTCAGAGAGGGCAGCTGG - Intergenic
1182048950 22:27298766-27298788 GAGATGAAGGAGAGGGGAAGAGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183690365 22:39384659-39384681 GAGAAGTAGGGGAGGGCAGCTGG - Exonic
1184409892 22:44320359-44320381 GGCATGGAGGAGAAGGCAGCAGG + Intergenic
1184465560 22:44667493-44667515 TAGAGGGAGGAGAGGGCATCTGG - Intergenic
1184831512 22:46991825-46991847 GAAATGGAGGCCAGGGCAGCTGG - Intronic
1184860048 22:47168479-47168501 GAGATGCTGGGGAGAGCAGCAGG + Intronic
1185145939 22:49136698-49136720 GAGGTGAAGGAGAGGAGAGCGGG + Intergenic
949099113 3:122107-122129 GATATGTAGATGATGGCAGCAGG - Intergenic
949977295 3:9472723-9472745 GAGATGGAGGAGAGGGAGGTGGG - Intronic
950922294 3:16706868-16706890 GAGCTGTAGGTGAGAGCAGTGGG + Intergenic
951113050 3:18828427-18828449 TACCTATAGGAGAGGGCAGCTGG + Intergenic
952361589 3:32635689-32635711 AAGATGTAAAAGAGGGCAGACGG - Intergenic
952910857 3:38184297-38184319 GAGCTGAAGGAGTGGGCTGCTGG + Intronic
953025406 3:39142223-39142245 GGGATGTAGGAGGGGGAAGGAGG - Exonic
953126491 3:40095845-40095867 GACAAGTGGGAGAGGGCAGAGGG - Intronic
953449660 3:42995728-42995750 GAGAAGAAGGGGAGGGGAGCAGG - Intronic
953550513 3:43898834-43898856 ATGAGGTAGGAGAGGGAAGCAGG + Intergenic
955881941 3:63556140-63556162 GTGATGGAGGACAGAGCAGCAGG + Intronic
956066897 3:65406224-65406246 AAGAAGTAGGAGAGCTCAGCTGG + Intronic
957282798 3:78175093-78175115 GAGGTGAAGGAGAGGGAAGAAGG - Intergenic
959511184 3:107214214-107214236 GAGATGTAGGAATGGCCAGTTGG - Intergenic
960939781 3:122926080-122926102 GCCATGTAGGGGAGGGGAGCAGG - Intronic
961864321 3:129942533-129942555 GAGATGGAGGAGGGAGGAGCTGG + Intergenic
963281362 3:143387598-143387620 GAGATGTACGAGGGCACAGCTGG - Intronic
967823779 3:193862435-193862457 GAGAGGAAGGAGAGGACAGGAGG - Intergenic
967945114 3:194797974-194797996 GCGAGGAAGGAGAGGGAAGCAGG - Intergenic
969699719 4:8761504-8761526 GAGGTGGAAGAGAGAGCAGCTGG - Intergenic
969728275 4:8938774-8938796 GACATGGAGCAGAGGGGAGCAGG + Intergenic
971356821 4:25902582-25902604 GTGAGGTAGAAGAGGTCAGCAGG + Intronic
971361347 4:25941099-25941121 GAAATCTAGGCGAGAGCAGCCGG - Intergenic
973532906 4:51850943-51850965 GAGTTGTGGGGGAGGGCAGAGGG + Intronic
974583582 4:63838892-63838914 GAGATATGGGAGAGGACAGTTGG - Intergenic
974924735 4:68283043-68283065 GATATGTAGGGCAGGGCAACAGG + Intergenic
976775732 4:88703928-88703950 GAGAGGGAGGAGAGGAGAGCTGG + Intronic
978158106 4:105512455-105512477 CACATGTAGGAGAATGCAGCTGG - Intergenic
979541612 4:121890150-121890172 CAGAAGTTGGAGAGGGCAGGGGG + Intronic
981224004 4:142270177-142270199 GAGATTGAGGAGAGAGAAGCAGG - Intronic
981225316 4:142287549-142287571 GAGATTTAGAAGAAGGCAGAGGG - Intronic
981884206 4:149653216-149653238 GAGATGGAGAAGATGGCAGCAGG + Intergenic
982097785 4:151938611-151938633 GAAATATAGGAGCGGGCAGCTGG + Intergenic
982720021 4:158849540-158849562 GAGATGTGGGAGGGGGCTTCTGG + Intronic
984183656 4:176515527-176515549 GAGATTTAGGAGCGGGCTGATGG - Intergenic
984750156 4:183264522-183264544 GAGATGTAGGATATGGCATGTGG + Intronic
985181409 4:187268229-187268251 GAGAGGTAGGAGGGGGCACCAGG - Intergenic
985784425 5:1886584-1886606 GAGAGGAGGGAGAGGGCCGCGGG - Intronic
986695815 5:10353750-10353772 GAGAGGAAGGAGAGGGGAGAGGG - Exonic
989997210 5:50849962-50849984 GAGAGGGATGAGAGGGAAGCAGG - Intergenic
990399874 5:55427783-55427805 GGGATGTGGGAGGGGGAAGCAGG + Intronic
990679829 5:58230079-58230101 GAGATGTGTGAGAGGGCAGAGGG - Intergenic
990980926 5:61602070-61602092 GAGTTGCAGGAGCTGGCAGCTGG - Intergenic
996122016 5:119683284-119683306 GAGAAGTTGGAGAAGGCAACTGG + Intergenic
997015071 5:129923187-129923209 GAGATGTAGGAGTGGGATGTGGG + Intronic
997208689 5:132065279-132065301 GACATGCTGGAGAGGGCAGTGGG + Intergenic
997335844 5:133108704-133108726 GAGATGTGGCAGTGGCCAGCAGG + Intergenic
997364937 5:133319607-133319629 GACAGGCAGGAGAGGGCAGTGGG + Intronic
997587874 5:135054490-135054512 GAGATGTAGGAGAGGTCTTTGGG + Intronic
997883377 5:137610608-137610630 GGGAAGCAGGAGAGGGCAGAGGG - Intergenic
998391279 5:141788514-141788536 GAGAAGTAGGAGAGAGAAGGAGG - Intergenic
998495336 5:142583556-142583578 GGGAAGTAGGAAAGGGAAGCAGG - Intergenic
999452866 5:151691506-151691528 GAGTGGTTGGAGAGGGCAGTGGG - Intergenic
1000674696 5:164106161-164106183 GAGATTTAGGAGGGGCCAGCAGG + Intergenic
1001532988 5:172477800-172477822 GAGAGGGAGCAGAAGGCAGCAGG - Intergenic
1001711139 5:173779139-173779161 AAGAGGTAGGAGAGGCAAGCAGG - Intergenic
1001718862 5:173840180-173840202 GAGGAGAAGGAGAGGGCAGGAGG + Intergenic
1001940504 5:175736555-175736577 GAAATGTAAGCGGGGGCAGCAGG - Intergenic
1002446838 5:179295266-179295288 GGGCTGTAGGACAGGGCAGAAGG - Intronic
1002581033 5:180209447-180209469 GAGGTGTAGGCTGGGGCAGCTGG - Intergenic
1002899548 6:1399463-1399485 GAGGAGGAGGAGAGGGAAGCAGG + Intergenic
1003230678 6:4250403-4250425 GAAATTTAGGAGAGGGAACCTGG + Intergenic
1004070922 6:12296713-12296735 GGGATGGAGGAAGGGGCAGCAGG - Exonic
1004255558 6:14060235-14060257 GAGATGCAGGAGCGGTCAGATGG - Intergenic
1004353575 6:14912201-14912223 GAGATGAAGGGGATGGTAGCTGG - Intergenic
1005465509 6:26108889-26108911 GGGATGTAGGGGTGGGCAGGGGG - Intergenic
1005494200 6:26374635-26374657 GAGCTGTAGAGGAGGGAAGCTGG + Intronic
1005498670 6:26411418-26411440 GAGCTGTAGAAGAGGGAGGCTGG + Intronic
1006544957 6:34772968-34772990 GAGTTGTAGGAAAGGTGAGCAGG - Intronic
1006912955 6:37575948-37575970 GGGATGTAGGAGAAGGAAGGTGG + Intergenic
1007125933 6:39425548-39425570 GAGAAGTAGGAGGATGCAGCAGG - Intronic
1007402175 6:41609069-41609091 GGGTTGTGGGAGAGGGCACCCGG - Intergenic
1007748335 6:44056861-44056883 GAGATGTAGGAGTGGACAGAGGG - Intergenic
1008700770 6:54096709-54096731 GATATTTATGAGAGAGCAGCTGG - Intronic
1010990908 6:82479125-82479147 CAGATGCAGGATTGGGCAGCCGG + Intergenic
1011610481 6:89146112-89146134 GAGAGGGCGCAGAGGGCAGCGGG + Exonic
1013414561 6:109913229-109913251 GAGAGGGAGGAGAGGGCTTCAGG + Intergenic
1013830083 6:114261418-114261440 TAGATGCATGAGAGGGAAGCTGG + Intronic
1013912043 6:115287574-115287596 GAGATGAAGGAAAGGGGAGTGGG - Intergenic
1015965753 6:138693609-138693631 GGGAAGTAGGAGAGAGCAGGGGG - Intergenic
1016476636 6:144434412-144434434 AAGATGAAGGAGAGAGAAGCTGG + Intronic
1017820899 6:158048423-158048445 GAGAGATAGGAGAGGTGAGCAGG + Intronic
1018376697 6:163219694-163219716 GAGCTGTAGGAGGAGGCAGGTGG - Intronic
1018710776 6:166496958-166496980 GAGTGGTGGGTGAGGGCAGCGGG - Intronic
1019223704 6:170494223-170494245 GAGAATGAGGAGAGGGCAGATGG - Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019571341 7:1713879-1713901 GAGAGGTGGGGGAGGGGAGCCGG - Intronic
1020825859 7:13027108-13027130 GAGATGTAGGAATGGGCGGTTGG - Intergenic
1021012830 7:15492880-15492902 AAGATGTAGGAGAAGACAGAGGG - Intronic
1023119764 7:36897564-36897586 GAGGAGTAGGAGAAGGAAGCTGG + Intronic
1024270138 7:47635767-47635789 GAGAGAGAGGAGAGGGAAGCAGG + Intergenic
1025020362 7:55475445-55475467 GGGATGTGGGAAAGGGCAACAGG + Intronic
1025020673 7:55476916-55476938 GAGATGGAGAATAGGGCAGGCGG - Intronic
1025029641 7:55546795-55546817 GCGATGGAGCAGAGGCCAGCAGG + Intronic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1028438148 7:90829230-90829252 GAGATTTGGGAGAGGCCAGGGGG - Intronic
1029440065 7:100582532-100582554 GAGGTGAGGGAGTGGGCAGCCGG - Intronic
1029623844 7:101707350-101707372 GAGGACTCGGAGAGGGCAGCAGG - Intergenic
1029675958 7:102069094-102069116 GAGGAGGAGGAGAGGGCGGCTGG - Intronic
1029888958 7:103906119-103906141 GAGGTGTGGGAAAGGACAGCAGG + Intronic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032805871 7:135353699-135353721 GTGATGCAGGAGAGAGTAGCAGG - Intergenic
1032915357 7:136483317-136483339 GTTATTTAGGAAAGGGCAGCTGG + Intergenic
1033136151 7:138786128-138786150 GAGGTGGAGAAGAGGGAAGCTGG - Intronic
1033139714 7:138814573-138814595 GGGATGTAGGTGAGGGGTGCTGG + Intronic
1033275306 7:139967214-139967236 GGGAGGAAGGAGAGGGCAGAAGG - Intronic
1033528129 7:142236813-142236835 GAGAAATTGGAGAGGGGAGCAGG + Intergenic
1033610832 7:142961889-142961911 GAGAAGGAGGAGAGAGAAGCTGG + Intronic
1034007604 7:147491208-147491230 GAGATGTAGGGGAGGAAATCAGG - Intronic
1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG + Intergenic
1037577626 8:20223020-20223042 CATATGGAGGAGGGGGCAGCTGG - Intronic
1037750941 8:21682023-21682045 GAGTGGGTGGAGAGGGCAGCTGG + Intergenic
1037806084 8:22058568-22058590 GAGAGGCAGGAGGGGGCACCTGG + Intronic
1038235286 8:25746862-25746884 TAGATGGAGGAGAGGGGAGAGGG - Intergenic
1038697524 8:29819422-29819444 GAGTTGTCAGAGGGGGCAGCAGG - Intergenic
1039475656 8:37838096-37838118 GAGAGGTAGGAGAGGCCAAAGGG - Intronic
1040294462 8:46142046-46142068 GAGATGTTGAAGCAGGCAGCGGG - Intergenic
1040831466 8:51681596-51681618 GGGTGGGAGGAGAGGGCAGCAGG - Intronic
1041003676 8:53478798-53478820 GTGCTGGAGTAGAGGGCAGCTGG - Intergenic
1041098983 8:54377947-54377969 GAGAAGCAGGACTGGGCAGCTGG - Intergenic
1041797556 8:61761267-61761289 GTGATGTAGGACAAGGCTGCAGG + Intergenic
1042164991 8:65936418-65936440 GAGATTTGGGAGGGGCCAGCAGG + Intergenic
1042339524 8:67664510-67664532 CAGGTGTGGGAGAAGGCAGCAGG - Intronic
1043745363 8:83868705-83868727 GAGATGTGAGAGGTGGCAGCAGG + Intergenic
1043824400 8:84907906-84907928 GAGAAACAGGAGAGGACAGCAGG - Intronic
1044014158 8:87030837-87030859 GAGAGGGAGGAGAGGGGAGGGGG - Intronic
1044075736 8:87820485-87820507 GAGATTTATGAGAGGGCGTCTGG - Intergenic
1044131646 8:88531060-88531082 GAGATGTAGGAGGAGGTAGTAGG + Intergenic
1047735528 8:127761665-127761687 AAGAAGTAGGAGAGTGCAGCAGG - Intergenic
1048799520 8:138183089-138183111 TATATGTAGGAGAGGGCACCTGG - Intronic
1051669638 9:19496476-19496498 GAGGGGTTGGAGAGGGCAACTGG + Intergenic
1053441458 9:38119844-38119866 GTTATGTAGGAAAGAGCAGCAGG - Intergenic
1053480719 9:38414519-38414541 GAGCTATAGCAGATGGCAGCCGG - Intronic
1055080336 9:72262347-72262369 GAAAGGTAGGAGAGGAAAGCAGG - Intergenic
1055440572 9:76332328-76332350 GGGAGGGAGGAGAGGGCTGCAGG - Intronic
1055489747 9:76792480-76792502 GAGAGGAATGAGAGGGCTGCAGG + Intronic
1055544494 9:77354966-77354988 GAGATGAAGAAGAGGACTGCTGG - Intronic
1057399903 9:94714120-94714142 GGGATGTGGGAGAGGGAAGGAGG + Intergenic
1057595565 9:96413477-96413499 GGGAAGTAGGATACGGCAGCCGG + Intronic
1057917290 9:99066426-99066448 GAGATGGAAGAAAGGGCTGCAGG + Intronic
1058667512 9:107334048-107334070 GATATGTAGGAGAGAGCTTCCGG - Intergenic
1058902502 9:109454237-109454259 GAGAGGTAGGAGGTGGCAGATGG + Intronic
1059413762 9:114150565-114150587 GAGAGGGAGGAGGTGGCAGCGGG + Intergenic
1059928595 9:119238580-119238602 GATATGTGGGAGAGGGGATCAGG - Intronic
1060252163 9:121995195-121995217 GAGAGGAAGAAGAGGGCACCTGG + Intronic
1060652088 9:125337025-125337047 GAGAAGGAGGAGAGGTCAGCTGG - Exonic
1062171190 9:135135764-135135786 AAGATTTAAGAGAGGGCACCTGG - Intergenic
1062185010 9:135213449-135213471 GGGATGGAGGGGAGGGCAGCTGG + Intergenic
1062186339 9:135220566-135220588 GAGCTGGAGGTGAGGGCAGGTGG + Intergenic
1062206634 9:135341241-135341263 GAGCTGCGGCAGAGGGCAGCGGG + Intergenic
1062368062 9:136221353-136221375 GAGAAGTAGGGGTGGGCACCAGG - Intronic
1185929804 X:4189760-4189782 GAGAGGTAGGAGAGAGCAAGAGG + Intergenic
1186532851 X:10314690-10314712 GAGAGGCAGGAGAGGGAAGGTGG + Intergenic
1187207863 X:17199895-17199917 AAGATGGAGAAGAGGGCAGAAGG + Intergenic
1187843760 X:23515210-23515232 GAGCTGTAGGTGCTGGCAGCTGG - Intergenic
1188659642 X:32743059-32743081 GAGATGCAGGAGCTGGCAGGTGG - Intronic
1188939358 X:36217534-36217556 GATAGGTATGGGAGGGCAGCAGG - Intergenic
1189578490 X:42381143-42381165 GAAATGAAGGAGAAGGAAGCAGG + Intergenic
1190715219 X:53097222-53097244 GAGGGGTATGAGAGGGCTGCCGG - Intergenic
1199638878 X:149840995-149841017 GAGAAGTGGAAGAGAGCAGCAGG + Intergenic
1199895694 X:152125691-152125713 AATCTGTAGGACAGGGCAGCAGG - Intergenic
1200103205 X:153698614-153698636 GAGATGTGGGAGCTGCCAGCAGG - Intergenic
1201187153 Y:11415760-11415782 GAAATGGAGGAGAGGGGAGGGGG - Intergenic