ID: 1078849043

View in Genome Browser
Species Human (GRCh38)
Location 11:15147352-15147374
Sequence TGCAGAAAATGAGATACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 406}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078849043_1078849047 28 Left 1078849043 11:15147352-15147374 CCTGCTGTATCTCATTTTCTGCA 0: 1
1: 0
2: 1
3: 44
4: 406
Right 1078849047 11:15147403-15147425 TGAGCACATAGCAGACTCATAGG 0: 1
1: 0
2: 1
3: 9
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078849043 Original CRISPR TGCAGAAAATGAGATACAGC AGG (reversed) Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
902885604 1:19402640-19402662 GGCAGAGCCTGAGATACAGCTGG - Intronic
903229678 1:21914228-21914250 TGCTGAAAAGGAAATACAGCAGG + Intronic
904438023 1:30511967-30511989 TGATGAAACTGAGATACAGAAGG - Intergenic
905745465 1:40413440-40413462 ATCAGAAAATGGGATACAGAAGG - Intronic
906687411 1:47771586-47771608 TGCACAAAAGGAGAAACAGAAGG + Intronic
906822744 1:48946513-48946535 TGCAGAAACTGAGGCACAGAGGG - Intronic
907062886 1:51449284-51449306 TGCAGCAAAATGGATACAGCTGG + Intronic
907391648 1:54161993-54162015 TGAGGAAACTGAGATACAGAGGG - Intronic
907570168 1:55476179-55476201 GGCATTAAATGAGATAAAGCTGG - Intergenic
907770305 1:57455353-57455375 TGAGGAAACTGAGATACATCTGG + Intronic
908482048 1:64550635-64550657 TGGAGAAAGTGAAGTACAGCAGG + Exonic
908594683 1:65674537-65674559 TGCAGACAAAGAGATAAAGAGGG - Intergenic
909350684 1:74649746-74649768 TTCTGAAGATGAGAGACAGCAGG - Intronic
909908660 1:81232457-81232479 GGCAGAAAAGGTGGTACAGCAGG - Intergenic
910114509 1:83717114-83717136 AGCAAAAACTGAGATACTGCGGG + Intergenic
912354920 1:109047014-109047036 TTCAATAAATGGGATACAGCCGG + Intergenic
912842063 1:113047626-113047648 TGAAGAAAATGAGGCACAGAGGG + Intergenic
912936962 1:114012109-114012131 TCCAGAAAATGACATCCAGGAGG - Intergenic
912965695 1:114235338-114235360 TGGAGAAAAAGAGGTACAGTTGG - Intergenic
913386723 1:118265805-118265827 TGCAGCAATTTGGATACAGCTGG + Intergenic
913588413 1:120299248-120299270 TGCAGCAAAAGAGATGCAGCTGG + Intergenic
913619772 1:120599121-120599143 TGCAGCAAAAGAGATGCAGCTGG - Intergenic
914570431 1:148911121-148911143 TGCAGCAAAAGAGATGCAGCTGG + Intronic
914602400 1:149219148-149219170 TGCAGCAAAAGAGATGCAGCTGG - Intergenic
915935129 1:160086007-160086029 GGCAGAAAAGGAGTGACAGCTGG - Intronic
915957710 1:160236526-160236548 TGAAGAAAATGAGGTTCAGAAGG + Intronic
916213151 1:162374500-162374522 TGCAGACAAAGAGAGCCAGCTGG - Exonic
916586515 1:166154330-166154352 TGGAGAAATTGAGATTTAGCCGG - Intronic
916758048 1:167792012-167792034 GGGAGAAGATGAGTTACAGCTGG + Intergenic
916777418 1:167981676-167981698 TGCAGCAACTAAGATGCAGCTGG - Intronic
917038070 1:170771363-170771385 TGCAGAAACATAGATGCAGCTGG + Intergenic
918173839 1:182025654-182025676 TGCAGAAAAAGAGAAAAGGCTGG + Intergenic
918250400 1:182698393-182698415 TGCAGAAACTGAGGCACGGCAGG - Intergenic
918425900 1:184409414-184409436 TGCAGAAAATGACCCACAGGTGG + Intronic
918710253 1:187718523-187718545 TGAATAAAATGAGAGAGAGCAGG + Intergenic
919032771 1:192265971-192265993 TGATGAAAATGAGACACAGAAGG - Intergenic
919384336 1:196899744-196899766 TGCAGAAAACCAGATATAGCTGG - Intronic
920325710 1:205162006-205162028 TGTAGGAAAGGAGATACAGCTGG - Intronic
920637647 1:207719819-207719841 TGTAGAAACTGAGACACAGAGGG + Intronic
921421186 1:214950703-214950725 TGCACAACAGGAGAAACAGCTGG + Intergenic
921457413 1:215389065-215389087 AGAAGAAAATGAGATTCAGGAGG - Intergenic
922971291 1:229742251-229742273 AACAGAAAATCAAATACAGCAGG - Intergenic
923485954 1:234431714-234431736 TGCAGTAAATGAGACACAGAGGG + Intronic
1062870736 10:901279-901301 TGCAGAAAATAAAATACAATAGG + Intronic
1063022432 10:2143261-2143283 TGCAGTGAATGAGTGACAGCTGG + Intergenic
1063022436 10:2143300-2143322 TGCAGTGAATGAGTGACAGCCGG + Intergenic
1063022441 10:2143339-2143361 TGCAGTGAATGAGTGACAGCCGG + Intergenic
1063650151 10:7927514-7927536 TGGAGAAACTGAGATACTGGTGG - Intronic
1063718978 10:8559358-8559380 TGAAGAAAGTGAGTTCCAGCAGG + Intergenic
1064128409 10:12685401-12685423 TGCAGAAACTCAGATATATCTGG - Intronic
1064263714 10:13807227-13807249 CTCAGAAAAAGAGATACAGGTGG - Intronic
1065056815 10:21853172-21853194 AGTAGAATATGAGATAAAGCTGG - Intronic
1065697940 10:28397382-28397404 TGCAGAAACATAGATACAGCTGG - Intergenic
1065927378 10:30447045-30447067 TTCAAAAATTGAGAGACAGCTGG - Intronic
1067088861 10:43256497-43256519 TGAAGAAAGTGAGGTGCAGCAGG + Intronic
1067677178 10:48391897-48391919 TGCAGATAATGAGATGCATAGGG + Intronic
1067737854 10:48872449-48872471 TAGAGGAAATGAGATAAAGCAGG + Intronic
1067775041 10:49157306-49157328 TGGAGAAAATGAGATAAGGCTGG + Intronic
1067961644 10:50859500-50859522 AGCAGAAAATAAACTACAGCAGG - Intronic
1068136745 10:52956395-52956417 TGCAGAAAATGATTAACAGCAGG + Intergenic
1068835492 10:61547978-61548000 TGCAGAAGTTGAGATACATTTGG + Intergenic
1069121620 10:64576103-64576125 AGCAGAAATTGAGATATAGTTGG + Intergenic
1069156137 10:65034009-65034031 TGCAGCAAGGGAGATGCAGCTGG + Intergenic
1069163471 10:65119053-65119075 TGCAGAAACATAGATGCAGCTGG - Intergenic
1069900416 10:71703683-71703705 TGAAGAAACTGAGGCACAGCGGG - Intronic
1070176721 10:73976773-73976795 CTCAGAAAATGAGAAACGGCTGG - Intergenic
1070580861 10:77718342-77718364 AGCAGAAAAAGAGGTTCAGCAGG + Intergenic
1070906445 10:80077797-80077819 TACAGAAACTAAGACACAGCCGG + Intergenic
1071454204 10:85831154-85831176 TGCAGAAAATTAGATGGAGATGG + Intronic
1072934507 10:99699465-99699487 AGCAGAAAATGATAGAAAGCTGG - Intronic
1073511737 10:104046775-104046797 TGCAGAAAATCAGACACAAGAGG + Intronic
1073568191 10:104553638-104553660 GGCAGAGAGTGAGAGACAGCCGG + Intergenic
1075235099 10:120720678-120720700 TGCAGAAATTGAGAGAGAGGAGG + Intergenic
1075506317 10:123025690-123025712 TGCAGAAAAAGAAATACAAATGG + Intronic
1076106368 10:127826858-127826880 TGCAGAAACTGAGACACGGTGGG - Intergenic
1076362349 10:129898100-129898122 TGCATAAAATGAGCTACAGTAGG + Intronic
1076705664 10:132300110-132300132 GGCAGAAAGTGTGATAGAGCAGG - Intronic
1078849043 11:15147352-15147374 TGCAGAAAATGAGATACAGCAGG - Intronic
1079033209 11:17001042-17001064 TGCAGAAAATGTGAAGGAGCTGG - Intronic
1079508429 11:21182135-21182157 TTAAGAAAATGAGCTCCAGCTGG + Intronic
1079621691 11:22563276-22563298 TGCAGAAATGTAGATGCAGCTGG - Intergenic
1080080733 11:28215441-28215463 TGAGGAGAATGAGAGACAGCAGG + Intronic
1080260606 11:30345888-30345910 TGCAGCAACATAGATACAGCTGG + Intergenic
1080906383 11:36549961-36549983 TGCAGAAACATAGATAAAGCTGG + Intronic
1080959287 11:37139424-37139446 TGCAGCAAATTGGATGCAGCTGG + Intergenic
1081726757 11:45335357-45335379 TGCAGAAACTAAGGTACAGAGGG - Intergenic
1082988768 11:59189420-59189442 TGCAGAAATTGAGGCACAGAGGG - Intronic
1085048450 11:73367060-73367082 AGCAGGAAATGAGGTACATCAGG + Intronic
1085238395 11:75032489-75032511 TGCAGAAAATGATAGAGAGACGG + Intergenic
1085556725 11:77429619-77429641 TGTAGAATATCAGATAAAGCAGG - Intronic
1085835626 11:79953296-79953318 TGGATAAAATGAGATAATGCAGG + Intergenic
1086280651 11:85183649-85183671 TGCAGTAAATGGGGTACAACAGG - Intronic
1086892764 11:92277551-92277573 TGCAGAAACATAGATGCAGCTGG + Intergenic
1087560964 11:99790073-99790095 TGCAGAAACACAGATCCAGCTGG - Intronic
1087885380 11:103475281-103475303 TGCAGAAAAGGAGATATATTAGG - Intronic
1087959437 11:104329654-104329676 AGTAGAAAATGAGAAAGAGCTGG + Intergenic
1087973250 11:104512062-104512084 TGCAAAAAATGAAATGTAGCTGG - Intergenic
1088025152 11:105170815-105170837 TGCAGAAACATGGATACAGCTGG - Intergenic
1088497470 11:110445680-110445702 AGCTGAAAAAGGGATACAGCTGG - Intronic
1089383192 11:118050695-118050717 TGCAGAAAATAGGATAAATCAGG + Intergenic
1089720588 11:120416521-120416543 TTTAGAAGATGAGAGACAGCTGG - Intronic
1090665096 11:128909654-128909676 TGCAGGAAAAGACATGCAGCTGG + Intronic
1090904739 11:131065419-131065441 TGGACAAGATGAGGTACAGCAGG - Intergenic
1091708498 12:2718259-2718281 TGCAGAAACATGGATACAGCTGG + Intergenic
1093003551 12:14026721-14026743 TGCAGAGAATGGAAGACAGCAGG + Intergenic
1093118023 12:15234852-15234874 TAGACAAACTGAGATACAGCAGG + Intronic
1093638648 12:21500927-21500949 TCCAGAAATTGAACTACAGCAGG + Intronic
1093688698 12:22085175-22085197 TGCAAAAGATGAGACCCAGCTGG + Intronic
1096884726 12:54705604-54705626 TGCAGCAAAATGGATACAGCTGG - Intergenic
1097916639 12:65027356-65027378 TGCAGCAACACAGATACAGCTGG - Intergenic
1098258441 12:68642642-68642664 TGTAGAATATGAGAAACAGATGG - Intronic
1098425110 12:70354696-70354718 TCCTAAAAATGAGGTACAGCAGG - Exonic
1099252044 12:80268362-80268384 TGAGGAAAATGGGATACAGGTGG + Intronic
1100174435 12:92013298-92013320 TGCAGCAACTTAGATGCAGCTGG - Intronic
1100375441 12:94011572-94011594 TATAGAAAATGAGTTTCAGCAGG - Intergenic
1100416983 12:94388273-94388295 TGCAGCAACACAGATACAGCTGG + Intronic
1100458690 12:94777250-94777272 TGCAGAAACTGAGATACAGGGGG + Intergenic
1102377618 12:112435531-112435553 TCCATTAAATGAAATACAGCAGG - Intronic
1103210950 12:119166014-119166036 TGCAGAAACTGAGGCACAGACGG + Intergenic
1103257000 12:119550443-119550465 TGAAGAAACTGAGACACAGAGGG + Intergenic
1104490552 12:129189970-129189992 GGCAGAAAATGAGAATCAGAGGG + Intronic
1106522437 13:30509622-30509644 TGAAGATAATGAGATAATGCAGG + Intronic
1106982180 13:35300429-35300451 TGAAGTAAATGAGATACACACGG - Intronic
1107675863 13:42796285-42796307 TGCAAAACCTGAGAGACAGCAGG + Intergenic
1108082823 13:46754863-46754885 TGCATAAAATCAGTTTCAGCTGG + Intergenic
1110338232 13:74357820-74357842 TGCAGCAACATAGATACAGCTGG + Intergenic
1111050529 13:82878071-82878093 TGCAGAAAATGTCATATAGAAGG + Intergenic
1111568361 13:90046940-90046962 TGCAGAAAAAGGGAGAGAGCAGG + Intergenic
1112556956 13:100477898-100477920 TGCAGAGCATGAGGAACAGCTGG + Intronic
1112676176 13:101704666-101704688 TTTAGAAAGTGAGACACAGCAGG - Intronic
1112736503 13:102426484-102426506 TGCAGAAGATGACATACCACAGG - Intergenic
1114203172 14:20542044-20542066 TGCAGACACTGAGAGACAGTGGG + Intergenic
1115237460 14:31221636-31221658 TGCAGAAAAAGAAATATACCAGG + Intergenic
1116152467 14:41158607-41158629 CGCAGAAACTGGGATACAGGGGG + Intergenic
1117225064 14:53649262-53649284 TGCAGAAAATGAGCAACAAAAGG + Intergenic
1118115155 14:62767518-62767540 TGCAGTAATGCAGATACAGCAGG + Intronic
1119173413 14:72551633-72551655 TGGAGAAAAAGGGATTCAGCTGG - Intronic
1119692293 14:76684469-76684491 TTCTGAAAATGACATACAGATGG - Intergenic
1120655697 14:87187393-87187415 TGCAGCAAATGACATACATTGGG + Intergenic
1121640777 14:95483463-95483485 TTCAGGAACTGAGTTACAGCTGG + Intergenic
1121874345 14:97437713-97437735 TGCAGAAAAGGGCTTACAGCTGG - Intergenic
1122418637 14:101561973-101561995 TGCCGAAATTGAGAACCAGCGGG - Exonic
1123114473 14:105888362-105888384 AACAGAAAATGAGAAGCAGCTGG - Intergenic
1123120910 14:105916636-105916658 AACAGAAAATGAGAAGCAGCTGG - Intergenic
1124396221 15:29304177-29304199 TAAAGAAAATGCCATACAGCCGG - Intronic
1124400927 15:29346525-29346547 TGGAGAAAATGGGAACCAGCAGG - Intronic
1125076441 15:35624277-35624299 TGCAGAAATTAAGATACAGAAGG + Intergenic
1125729709 15:41886267-41886289 TGCAGAGAAGCAGATGCAGCTGG - Exonic
1125891128 15:43268032-43268054 TGGAGAATATGAGAAACAGCTGG - Intergenic
1127018370 15:54715401-54715423 TGGTGAAAATGAGGTACAGAGGG - Intergenic
1129356894 15:74997295-74997317 TGGAGGAAGTGTGATACAGCAGG + Exonic
1130148852 15:81295991-81296013 TGCAGACAATCAAATACAGGTGG + Intronic
1130520806 15:84659174-84659196 TGAAGAAAGTGAGGTTCAGCCGG - Intergenic
1131658130 15:94483550-94483572 TGCAGGAACTTGGATACAGCTGG + Exonic
1131797274 15:96031992-96032014 TAAAGAAAATGAGATAAACCAGG + Intergenic
1134910728 16:18023792-18023814 TGCAGAAAATGACCCATAGCAGG - Intergenic
1135910547 16:26556718-26556740 TGCAGGAAATCTGAGACAGCTGG - Intergenic
1137522558 16:49207309-49207331 TACATAAAATCAGTTACAGCAGG + Intergenic
1137902721 16:52286700-52286722 TGCAGCAATGTAGATACAGCTGG + Intergenic
1137915527 16:52425939-52425961 TGTAGCAAATGAAATACAGAAGG + Intergenic
1138267715 16:55671823-55671845 TGCAGGAAACGAGAGACAGAGGG + Intronic
1138935879 16:61722243-61722265 TGGAAAAAATGAGAAAGAGCTGG - Intronic
1140504379 16:75461644-75461666 TGCCAAAGATGAGACACAGCAGG + Intronic
1140686179 16:77435449-77435471 TGAGGCAAATGCGATACAGCAGG - Intergenic
1140998294 16:80282919-80282941 TGCTGAAATTGGGACACAGCTGG - Intergenic
1143238229 17:5421303-5421325 TGGAGAGAATGAGAAACAGCCGG + Exonic
1143263850 17:5620946-5620968 TGAAGAAACTGAGATGCAGAGGG - Intergenic
1144039775 17:11400032-11400054 TGTAGAAAAGAAGATACAGAAGG - Intronic
1144348714 17:14373522-14373544 TGCTGAAAATGGAATACAGCTGG + Intergenic
1144506537 17:15836179-15836201 GGCTGAGAATGAGATACTGCTGG - Intergenic
1145170711 17:20654111-20654133 GGCTGAGAATGAGATACTGCTGG - Intergenic
1147614099 17:41818358-41818380 TGCAGAAAATGAGGTGGAGGTGG - Intronic
1148076758 17:44941633-44941655 TGTTGAAAATTAGGTACAGCTGG - Intronic
1149090187 17:52768950-52768972 TGCAGCAAATTGGATAGAGCTGG + Intergenic
1150038149 17:61827116-61827138 TACAGAAACTTAGATAGAGCTGG + Intronic
1150179502 17:63102001-63102023 AGTAGAAAATGAGTTAGAGCTGG + Intronic
1150423998 17:65062611-65062633 AGCAGAGAATGAGATAAAGTAGG - Intergenic
1151081287 17:71332532-71332554 TCCAGAAATTGAGGTTCAGCAGG + Intergenic
1151270787 17:72994125-72994147 TGAAGCAAATGAAATACTGCAGG - Intronic
1153045475 18:851954-851976 TAAAGAAAATGTGATCCAGCCGG + Intergenic
1153062347 18:1007134-1007156 GGCAGATAACAAGATACAGCAGG - Intergenic
1153695435 18:7636012-7636034 TGGAGAGAATGAGAGACTGCAGG + Intronic
1156548043 18:37985430-37985452 TGCAGAAACTGAAAAAAAGCAGG - Intergenic
1156574280 18:38296263-38296285 TGTAGAAGATGAGATACAGATGG + Intergenic
1156694614 18:39752121-39752143 TGCAGAAAATGAAACAAATCTGG - Intergenic
1157237656 18:45979500-45979522 TGCATAAAAAGAAATACAGCTGG - Intergenic
1157600508 18:48890268-48890290 TGGGGAAACTGAGACACAGCAGG - Intergenic
1158050067 18:53207160-53207182 TGCAGTAAATGAGATACTGGAGG - Intronic
1158756254 18:60329271-60329293 TGCAGATAAGAAGAAACAGCAGG - Intergenic
1161111413 19:2472820-2472842 CTCAGAAAATGAGCTCCAGCCGG - Intergenic
1161642989 19:5435989-5436011 TGGGGAAAAACAGATACAGCGGG - Intergenic
1161739448 19:6011654-6011676 TGCAGACAACGAGGTACAGAAGG + Intronic
1162224271 19:9206586-9206608 TTAAGGAAATGATATACAGCAGG + Intergenic
1163122587 19:15226896-15226918 GGAAAAAAATGAAATACAGCTGG + Intergenic
1164528523 19:29029463-29029485 TGCAGAGAAAGAGATCCAGAGGG + Intergenic
1164988707 19:32668925-32668947 TGAAGAAACTGAGATGCAGCTGG + Intronic
1165719560 19:38069425-38069447 GCCAGGACATGAGATACAGCAGG - Intronic
1167202383 19:48074939-48074961 TGCAGAAGATGAGGCAGAGCAGG - Intronic
1167218240 19:48179468-48179490 TGTAGAAAATGAAATAGGGCCGG - Intronic
1167972766 19:53198764-53198786 TGAATGAAATGATATACAGCAGG + Intergenic
1168024660 19:53635168-53635190 TACAAAAAATAAAATACAGCCGG - Intronic
926559326 2:14398673-14398695 TACTGAAAAAGAGATACAGTAGG + Intergenic
927834368 2:26380901-26380923 TGCAGAAAAGGACATACAAACGG - Intronic
928423585 2:31159452-31159474 TGAAGAAACTAAGATTCAGCGGG + Intergenic
929389978 2:41458788-41458810 CCCAGAGGATGAGATACAGCAGG + Intergenic
931926816 2:67082405-67082427 TGTAGAAACTGAGATTCAGAGGG - Intergenic
931956398 2:67430725-67430747 TACTAAAAATGAGATACAGCTGG - Intergenic
932296998 2:70633249-70633271 TGCAGAAAATGAGTTATTTCTGG - Intronic
933146324 2:78857994-78858016 GGTAGAAAATGAGAAAAAGCTGG + Intergenic
933299292 2:80524377-80524399 AGAAGAAAATGAGAAAGAGCAGG - Intronic
933417415 2:82003950-82003972 TGCTAAAAATGAAATAAAGCAGG - Intergenic
934138611 2:89022183-89022205 TGCAGAAACTTGGATGCAGCTGG + Intergenic
934144702 2:89080245-89080267 TGCAGAAACTTGGATGCAGCTGG + Intergenic
934224553 2:90120306-90120328 TGCAGAAACTTGGATGCAGCTGG - Intergenic
934230634 2:90178380-90178402 TGCAGAAACTTGGATGCAGCTGG - Intergenic
935186571 2:100739646-100739668 TGCAGAAAAAGATATACAAATGG + Intergenic
935951010 2:108328681-108328703 TGAAGAAATTGAGATACAGAGGG + Intergenic
938186708 2:129238641-129238663 GGCAGAAAATGAACTAAAGCAGG + Intergenic
938226594 2:129621908-129621930 TGCAGAAAAACAAATACTGCAGG + Intergenic
938992970 2:136648099-136648121 TGCAGAATATGAAATAAAGGAGG - Intergenic
940892085 2:159044868-159044890 TGCAGAAAATGAAATCCTGCTGG - Intronic
942307826 2:174625943-174625965 TGTAGAAAAGGAGATACCGCTGG - Intronic
942454353 2:176128173-176128195 TGGAGAAAATGAGATCGAGATGG - Intergenic
942589249 2:177523309-177523331 TACTGAAAATAAGATACTGCAGG + Intronic
942835162 2:180286840-180286862 TGCAGCAAAATAGATGCAGCTGG + Intergenic
943613153 2:190058700-190058722 TGCAGCAAATTAGATGGAGCTGG + Intronic
943896987 2:193376662-193376684 TGCAAAAAATCAGAAAAAGCAGG - Intergenic
944406106 2:199385485-199385507 TGCAGAAAATAAGAGACTGAGGG - Intronic
944617155 2:201473086-201473108 TGAAGAAAATGATACACAGTTGG + Intronic
946380904 2:219348205-219348227 TGGAGAAAAAGAGCTACAGCTGG - Intergenic
948484765 2:238273468-238273490 TGGAGAACATGAGAGGCAGCTGG - Intronic
1168911231 20:1448749-1448771 TGAAGAAACTGAGGCACAGCAGG + Intronic
1169742610 20:8911478-8911500 TGTAGAAAAGAAGCTACAGCAGG - Intronic
1173117747 20:40262338-40262360 TTCAGGAAATGAGATTCTGCTGG - Intergenic
1173131138 20:40394700-40394722 TTCAGAGTATGAGAAACAGCAGG - Intergenic
1173795347 20:45855930-45855952 TACAGAAAATGCCAAACAGCTGG - Intronic
1173891738 20:46517679-46517701 TGGAGATAATGAGATAAAGAAGG - Intergenic
1174536881 20:51258252-51258274 TACAGATAATGAGATGCAGAGGG + Intergenic
1175104967 20:56608574-56608596 AACAGAAAATGAGACATAGCTGG + Intergenic
1177147606 21:17423302-17423324 TGCAGTCAAGGAGATCCAGCAGG - Intergenic
1181449326 22:23007798-23007820 TGCACAGCCTGAGATACAGCAGG + Intergenic
1183150208 22:36030882-36030904 TGAAGAAACTGAGACACAGAGGG - Intergenic
1184052611 22:42019287-42019309 TGTAGAAAATGAGGAACAGACGG - Intronic
1185058474 22:48593267-48593289 TGCAGAGGCTGAGATGCAGCTGG + Intronic
949331658 3:2930177-2930199 TGAAGAAAATCAGATACAAGGGG - Intronic
950796300 3:15513181-15513203 TGCAGAAGTTGGGATCCAGCGGG - Intronic
951021658 3:17787459-17787481 TGCAGCAACATAGATACAGCTGG - Intronic
951253397 3:20420333-20420355 TGGAGAAAATGAGATGGGGCAGG - Intergenic
951571688 3:24070642-24070664 TGCAGCAAAACAGATGCAGCTGG - Intergenic
954506356 3:51078882-51078904 AGCAGAAAATGAAATAAAGAGGG - Intronic
955723176 3:61904971-61904993 TGCAGGAAAAGACAGACAGCAGG - Intronic
956078180 3:65528537-65528559 TTCAGAAATTGAGATGCAGATGG - Intronic
956850808 3:73226760-73226782 TGCAGTAACAAAGATACAGCTGG + Intergenic
957396648 3:79647756-79647778 TTGAGCTAATGAGATACAGCAGG + Intronic
958119042 3:89260963-89260985 TGCAGATAATGGAAGACAGCAGG - Intronic
959153096 3:102631028-102631050 AGGACAAAATGAGATAAAGCAGG - Intergenic
959571515 3:107889402-107889424 TGCAGAAAATATGATAAAGGAGG + Intergenic
959857543 3:111176811-111176833 TGTAGAAAATGAAATACAAAAGG - Intronic
959979295 3:112497022-112497044 TTCAGAAAATGAAATATGGCTGG - Intronic
960071908 3:113440630-113440652 TGTAGAAAATGGGTTACAGAAGG - Intronic
960963770 3:123090597-123090619 CAGAGAAAATGAGAGACAGCGGG - Intronic
963582738 3:147147301-147147323 GGCAGAAACAGAGCTACAGCAGG + Intergenic
964082767 3:152779878-152779900 TGCAGAAAATGGGAGGCAGCTGG + Intergenic
964366346 3:155954509-155954531 AGCAGAAAATCAAATACTGCAGG - Intergenic
964541034 3:157780288-157780310 TGCAGCAACTCAGATAGAGCTGG + Intergenic
965390531 3:168097435-168097457 TGAAGAAAAAGACATAGAGCAGG - Intergenic
965966406 3:174495688-174495710 AACAGAAAAAGACATACAGCTGG - Intronic
966703620 3:182885260-182885282 TGCATAAAATGAAATACATAGGG + Intronic
967443940 3:189542803-189542825 GGCAGAAACTGGGATACATCTGG - Intergenic
967967831 3:194975971-194975993 TTGAGAAAATGATATACAGAAGG + Intergenic
968459842 4:719247-719269 TTAAGAAAATGAAAAACAGCCGG - Intronic
969301787 4:6301325-6301347 TGCGGAAGAAGAGATAGAGCAGG - Exonic
969894799 4:10293377-10293399 TGCAGAAAATAAAACACATCTGG + Intergenic
970143082 4:13003832-13003854 TGAAGAAACTAAGGTACAGCTGG - Intergenic
970259963 4:14213904-14213926 TGCAAAAACACAGATACAGCTGG - Intergenic
972132919 4:35860112-35860134 TGTAGAAAATGGGATACAAAGGG - Intergenic
972341972 4:38160005-38160027 TGCAGAGAATGAGTTAGAGGGGG - Intergenic
973038236 4:45435974-45435996 TGCAGAAATTGAGATTCAAGGGG - Intergenic
973073501 4:45894814-45894836 TGCAGCAGGTGAGATAGAGCAGG - Intergenic
973226730 4:47793443-47793465 TAAGGAAAATGAGAAACAGCAGG + Intronic
973623207 4:52747739-52747761 TAAAGAAACTGAGATGCAGCCGG + Intronic
974574625 4:63702047-63702069 ATCAGAAAATGAAATACATCAGG - Intergenic
974919294 4:68218442-68218464 TGCAGAAATTGATTTACAGAGGG + Intergenic
975351169 4:73349039-73349061 TGCAGAAACATGGATACAGCTGG + Intergenic
977086567 4:92606341-92606363 TGAAGAAAATGAGCAACAGCTGG + Intronic
977277974 4:95002280-95002302 TGCAGCAACTTAGATGCAGCTGG - Intronic
977490754 4:97707054-97707076 TGAAGCAAATGAGATCTAGCAGG + Intronic
978115468 4:105015197-105015219 TGCAGATAATGAGATAGCGATGG - Intergenic
978367908 4:108001905-108001927 TGCATGAAATTAGATACAGTTGG - Intronic
978972548 4:114827810-114827832 TGCAGAAAGTGAGATAGCACTGG - Exonic
980726067 4:136762355-136762377 TGAGAAAAATGAGATACAGAAGG - Intergenic
980764463 4:137282445-137282467 TGAAGAAATTGAGATTCAGAGGG - Intergenic
980864030 4:138532735-138532757 TGCTGAAAATGAGATATTGAAGG - Intergenic
980969803 4:139557253-139557275 TGGAGAAACAGAGAGACAGCTGG - Intronic
981304490 4:143232172-143232194 TGCAGAAAATTACTTACAACAGG + Intergenic
981506121 4:145501608-145501630 TCCAAAACATGAAATACAGCAGG + Intronic
981821326 4:148890387-148890409 TGAGGAAAAGAAGATACAGCAGG - Intergenic
982800192 4:159696879-159696901 TGCAGAAAAAGAAATTCAGAAGG - Intergenic
983313003 4:166089350-166089372 GGCAGAAAATGAGATTTAGTAGG + Intronic
984407046 4:179346427-179346449 TGAAGAAAATGAGATTCAGGGGG - Intergenic
984421768 4:179532421-179532443 TGAAGAAATTGAGATCCAGAGGG + Intergenic
984825195 4:183918096-183918118 TGCAGAAGAAGAGAGCCAGCGGG + Intronic
985068624 4:186146249-186146271 TGCTTAAAAGGAGATACAGAGGG + Intronic
985394007 4:189522146-189522168 TGCAGCAACTCAGATAAAGCTGG - Intergenic
986347426 5:6847721-6847743 TGCAGAAACATGGATACAGCTGG - Intergenic
988202594 5:28086614-28086636 GGCTGAGAATGAGCTACAGCAGG + Intergenic
988220138 5:28333917-28333939 TGCAGAGACAGAGGTACAGCAGG - Intergenic
992089430 5:73303991-73304013 AGGAGAAAATGAGATAAAGCCGG - Intergenic
993783619 5:92100967-92100989 TGCAGTAAAAGGGATGCAGCTGG + Intergenic
993858208 5:93101531-93101553 TGCAGAAATGAAGATACATCTGG + Intergenic
994043101 5:95280576-95280598 TGCAGAAAATGAAATGCATCTGG + Intronic
994402159 5:99294760-99294782 TTTAGAAAATGAGAAACAGGAGG + Intergenic
994938871 5:106293549-106293571 TACAGCAACTGAAATACAGCAGG + Intergenic
995109764 5:108416240-108416262 TGAAGAAAATGATATACAGTTGG + Intergenic
996201597 5:120682566-120682588 TGCAGCAAATGAGAGAAAACAGG - Intronic
996659936 5:125989524-125989546 AACAGAAAAGGAGATAGAGCAGG - Intergenic
997072627 5:130637708-130637730 TGCAGAGAATGGGATACAAAGGG + Intergenic
997356810 5:133267667-133267689 TTCAGAAACTGAGACACACCTGG + Intronic
997472977 5:134127062-134127084 TACAGCAAATGGGATAGAGCAGG - Intronic
997600606 5:135135892-135135914 TGCAGGAGATGAGGTACAGATGG + Intronic
997632763 5:135381712-135381734 TACAGCAGATTAGATACAGCTGG + Intronic
999120746 5:149207402-149207424 GGCAGTAAATGAGAGACGGCCGG - Intronic
1000383680 5:160652149-160652171 AGCAGGAAAGGAGACACAGCAGG - Intronic
1000895045 5:166845336-166845358 GACAGAAAAAGAGAGACAGCAGG + Intergenic
1003444592 6:6173089-6173111 GGCAGAGAATGAGTTAGAGCAGG - Intronic
1003770928 6:9299258-9299280 TGGAAAAAATAAGATTCAGCAGG - Intergenic
1003957441 6:11176835-11176857 TAAAGAAAATGAGATCCGGCCGG - Intergenic
1004873329 6:19929968-19929990 TGAAGAAACTGAGATTCAGGAGG + Intergenic
1006762518 6:36475636-36475658 AGCAGAGAATGAGATTTAGCAGG - Intronic
1007157712 6:39761880-39761902 TAAAGAAAATGTGGTACAGCTGG - Intergenic
1008608883 6:53167557-53167579 TGGAGCAACTGAGATACAACAGG + Intergenic
1008816935 6:55579336-55579358 TGCGGAAAATGAGACACCCCTGG - Intergenic
1009517003 6:64633427-64633449 TGCAGAAATTAAGACAGAGCTGG + Intronic
1009571488 6:65390942-65390964 TGGACAAAATGAGATACAGAGGG + Intronic
1011624438 6:89271724-89271746 TGCAGAAGAGCAGAGACAGCTGG + Intronic
1012330773 6:97983292-97983314 TGCAGAAAATGAGCCAGGGCGGG + Intergenic
1012631788 6:101479001-101479023 TTGAGAAAATGAGACACAACTGG + Intronic
1013098102 6:106964245-106964267 TGCAGCACCTCAGATACAGCTGG - Intergenic
1013824746 6:114197775-114197797 TGCAGCAACATAGATACAGCTGG - Intronic
1014527096 6:122513774-122513796 TGCAGCAACATAGATACAGCTGG - Intronic
1015478925 6:133685944-133685966 TGTAGAAAATCAGCTACATCAGG + Intergenic
1016179494 6:141126661-141126683 GGCAGAAAAAGAGAAACAGAGGG + Intergenic
1016223924 6:141710465-141710487 TGCAGCAAAACGGATACAGCTGG + Intergenic
1016701174 6:147055960-147055982 GGCAGAGAATGTGATAAAGCAGG + Intergenic
1017060504 6:150480374-150480396 TGCAGGAAATTGGATAGAGCTGG - Intergenic
1017442983 6:154481718-154481740 TGAAAAAAATGAGTGACAGCAGG + Intronic
1018319834 6:162595985-162596007 TGTAGAAACTCAGATACATCTGG + Intronic
1018402963 6:163444306-163444328 TGAAGAAAATGAGACCCAGAAGG + Intronic
1018550614 6:164993602-164993624 TACAGAAAGTGAGGTAAAGCAGG + Intergenic
1019988003 7:4672210-4672232 TCTAGAAAATGAGGTATAGCTGG - Intergenic
1020011177 7:4806619-4806641 TGCAGAAAATAAGAACCGGCTGG - Intronic
1020752108 7:12155212-12155234 TGAAGAAATTGAGAGAAAGCTGG + Intergenic
1021910065 7:25376665-25376687 TGCAGAAAATCTGATTCAGTGGG + Intergenic
1021978729 7:26033685-26033707 TACAGAGAAGGAGAAACAGCTGG - Intergenic
1022592842 7:31682332-31682354 TGCAGAAGAGGATATACAGATGG + Intergenic
1024833057 7:53484295-53484317 TGCAGAAACTGAGACACAGAGGG - Intergenic
1024833309 7:53486953-53486975 TGCAGAAACTTAGATGAAGCTGG - Intergenic
1024843534 7:53615765-53615787 TGCAGAAATTCTGATACAGCAGG + Intergenic
1024958971 7:54955702-54955724 TGCAGAAAACAAGAAGCAGCAGG + Intergenic
1025721718 7:64021913-64021935 AGGAGAAAATGATACACAGCAGG - Intergenic
1027351971 7:77321385-77321407 TGTGGCAAATGAGATCCAGCTGG + Exonic
1027408030 7:77883308-77883330 TGCAAAAAATAAGAGACATCTGG - Intronic
1027653177 7:80896890-80896912 TGAAGAAATTGAGATACACAGGG - Intronic
1028418483 7:90606165-90606187 TGAAGAAATTGAGATCCAGAAGG + Intronic
1029501967 7:100936983-100937005 TGCAGCAACGGGGATACAGCTGG - Intergenic
1029543872 7:101200306-101200328 TGCGGACAATGAGATACTGGTGG + Intronic
1031100442 7:117473284-117473306 TGAAGAAACTGAGGTACAGAAGG - Intronic
1031838065 7:126703024-126703046 TGCGGAAAATGAGACACTGTGGG + Intronic
1031838076 7:126703166-126703188 TGCAGAAAAGGAATTAAAGCAGG + Intronic
1031919773 7:127592067-127592089 TTCAGAAAATGTGATTCATCAGG + Intronic
1031942094 7:127799782-127799804 TGGAGAGAATGAAATAGAGCTGG + Intronic
1032179759 7:129664740-129664762 TGTGGAAAGTGAGACACAGCTGG + Intronic
1033004159 7:137542404-137542426 TCCATACAATGAAATACAGCTGG + Intronic
1033659435 7:143393471-143393493 TGCAGAAAATCAGTTATGGCTGG - Intronic
1033917122 7:146339872-146339894 TACATAAAATGAAATACAGCGGG + Intronic
1034668522 7:152839478-152839500 TGCCAAAAATGGGATAAAGCAGG - Intronic
1035031226 7:155862234-155862256 TGCTGAAATTGAGCCACAGCAGG - Intergenic
1035660310 8:1342926-1342948 TACGGAAAAAGAGAAACAGCTGG - Intergenic
1035933929 8:3816278-3816300 TGCAGAGAATGAGGAACAACTGG - Intronic
1036278441 8:7378052-7378074 AGTTGAAAATGACATACAGCAGG + Intronic
1036343082 8:7933834-7933856 AGTTGAAAATGACATACAGCAGG - Intronic
1038623406 8:29167014-29167036 TGCAGAAAATGATGGAGAGCAGG - Intronic
1040551492 8:48440910-48440932 TACAGAAAAGGAGATTCAGCTGG + Intergenic
1041282401 8:56224237-56224259 TTCAGAAAATAGGATACATCGGG - Intergenic
1041399481 8:57427196-57427218 TGCAGCAACACAGATACAGCTGG + Intergenic
1041445626 8:57948450-57948472 TTCAGACACTGTGATACAGCAGG - Intergenic
1041922744 8:63200943-63200965 TACAGAAAAAGAGATAAAGTTGG + Intronic
1042780680 8:72487664-72487686 TGCAGAAATGTAGATGCAGCTGG + Intergenic
1043152930 8:76741158-76741180 TGCAGCAAATGCTATACAGAGGG + Intronic
1043955037 8:86349865-86349887 TGCAGAAAATGGGCCACAGATGG + Intronic
1044169673 8:89034040-89034062 TGCAGCAACTGGGATGCAGCTGG + Intergenic
1044244832 8:89930772-89930794 GGCAGAAAAAGAGAAACAGATGG + Intergenic
1044470045 8:92556225-92556247 TACAGAAATTGAGATAGAGAAGG + Intergenic
1047383719 8:124388705-124388727 TGCAGCAAATTGGATAGAGCTGG - Intergenic
1048048426 8:130794802-130794824 TCTACAAAATGAGATACAGTAGG - Intronic
1048065358 8:130962149-130962171 TGCAGAAAATGCTTTACAGAGGG - Intronic
1048209370 8:132442266-132442288 TGCTGAAACTGAGATACATATGG - Intronic
1048256552 8:132909237-132909259 TGCAGAACATGAGAAGCAGCAGG + Intronic
1050179084 9:2900448-2900470 TGTAGAATATGAGAAACAGAAGG - Intergenic
1050225411 9:3449079-3449101 TGGAAAAAATGAGGTACAGAGGG - Intronic
1051149938 9:14069267-14069289 TGGACAATATGAGAAACAGCTGG + Intergenic
1052607797 9:30727435-30727457 AGCAGAATATGAGATACATATGG - Intergenic
1053055497 9:34991122-34991144 TACAGAAAATGAGGTACTGATGG - Intronic
1053191626 9:36075957-36075979 TGATGAAAATGAGAGAGAGCTGG + Intronic
1054904120 9:70399961-70399983 GGCAGAAAAAGAGAAAGAGCTGG + Intronic
1055114957 9:72596234-72596256 TGCAGAGAAGGTGATACAGATGG - Intronic
1055201606 9:73669752-73669774 TGGAGAAAATGAGATAATGAGGG + Intergenic
1055240785 9:74183371-74183393 AGCAGAAAAGGGGATGCAGCAGG + Intergenic
1055245400 9:74235607-74235629 TGAACAAAAGGAGATACACCTGG - Intergenic
1055275070 9:74606046-74606068 TGAAGAAACTGAGGCACAGCAGG - Intronic
1056109653 9:83382475-83382497 TGAAGAAATTGAGACACAGAGGG + Intronic
1056160203 9:83882721-83882743 AGCAGAAAAGGATATACAGCAGG + Intronic
1056360023 9:85847111-85847133 AGCAGAAAAGGATATACAGCAGG - Intergenic
1056473252 9:86926493-86926515 AGCAGAAAATTAGATTCAGAGGG - Intergenic
1059229942 9:112710872-112710894 TACAGAAAGTAAAATACAGCCGG + Intronic
1059376442 9:113885269-113885291 TGCAGAAATTAAGATACGGAAGG - Intronic
1059645288 9:116260152-116260174 GGAAGGAAATGAGATACAGGAGG + Intronic
1060009335 9:120029778-120029800 TTCAGAAAATGAGCTGCAGTAGG - Intergenic
1061068965 9:128296889-128296911 GGCAGTCAATGAGATACTGCGGG - Intergenic
1062654568 9:137596396-137596418 TAAAGAAAATGTGGTACAGCCGG + Intergenic
1185502778 X:611137-611159 TGCAGAAACACAGATGCAGCTGG - Intergenic
1185716801 X:2349270-2349292 TGAAGAAAATGCGGTACAGCTGG + Intronic
1185912151 X:3991408-3991430 TGCAGCAACATAGATACAGCTGG - Intergenic
1186124785 X:6401407-6401429 TGCAGAAATTGAGAAAAAGTGGG - Intergenic
1186300915 X:8198983-8199005 TGCAGAAAATGATATGCAAATGG - Intergenic
1186539042 X:10381631-10381653 TCCAGAAAGAGAGATACAGAAGG - Intergenic
1188165943 X:26864041-26864063 TGCAAAAACTGAGATAGAGAAGG + Intergenic
1188715936 X:33458929-33458951 TGCAGCAACATAGATACAGCTGG + Intergenic
1188840587 X:35012216-35012238 TGCAGCAAAGCAGATAGAGCTGG + Intergenic
1188994172 X:36861940-36861962 TGAAAAAATTGAGATACAGTAGG + Intergenic
1190680087 X:52819093-52819115 TGCAGATAAAGAGATACATAGGG - Intergenic
1193099902 X:77598128-77598150 TGCAGCAACAGGGATACAGCTGG + Intronic
1194021032 X:88692719-88692741 TGCAGCAACTTAGATGCAGCTGG + Intergenic
1194067055 X:89274402-89274424 TGCAGAAACATAGATACAGCTGG - Intergenic
1194397315 X:93402189-93402211 AGAAGAACATGAGATACAGGAGG + Intergenic
1194487478 X:94503250-94503272 TGCAGAAAATGAATTACAAGGGG - Intergenic
1194789643 X:98131034-98131056 TGCAGCAACAGGGATACAGCTGG - Intergenic
1195058834 X:101174509-101174531 TGCAGCAACATAGATACAGCTGG + Intergenic
1195487964 X:105431952-105431974 TGCAGGAAATGAGATCCAGGTGG + Intronic
1195824318 X:108981376-108981398 TGCAGAAACATGGATACAGCTGG + Intergenic
1196470610 X:116020492-116020514 TGCATAGAATGAGATACAGAGGG + Intergenic
1196475970 X:116086994-116087016 TGAAGAAACTGAGATTCAGAAGG + Intergenic
1197115425 X:122826868-122826890 TGCAGCAACAGGGATACAGCTGG + Intergenic
1197571425 X:128155679-128155701 TGCAGAAAATGTGGAGCAGCTGG - Intergenic
1198074279 X:133179804-133179826 TGAACAAAATGTCATACAGCTGG - Intergenic
1198198326 X:134387647-134387669 TGCAGAAAGTCAGATAGAGTTGG + Intronic
1198454945 X:136807678-136807700 TTCACTATATGAGATACAGCTGG - Intergenic
1198831045 X:140750918-140750940 TGCAGAAACTTGGATGCAGCTGG - Intergenic
1198921627 X:141735046-141735068 AGCAGAAAATGTGATGCACCTGG + Intergenic
1199753169 X:150840364-150840386 TACAGAAAATGTGATAAATCTGG + Intronic
1200721215 Y:6608595-6608617 TGCAGAAACATAGATACAGCTGG - Intergenic