ID: 1078851944

View in Genome Browser
Species Human (GRCh38)
Location 11:15171968-15171990
Sequence ACATGGCCACAGATGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 1, 2: 6, 3: 42, 4: 355}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078851939_1078851944 2 Left 1078851939 11:15171943-15171965 CCAGGGGCATTTTAACACAGACT 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1078851944 11:15171968-15171990 ACATGGCCACAGATGGCCAGGGG 0: 1
1: 1
2: 6
3: 42
4: 355
1078851933_1078851944 30 Left 1078851933 11:15171915-15171937 CCACCGCTGGATCAAGCACCAAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1078851944 11:15171968-15171990 ACATGGCCACAGATGGCCAGGGG 0: 1
1: 1
2: 6
3: 42
4: 355
1078851938_1078851944 12 Left 1078851938 11:15171933-15171955 CCAATTGTTTCCAGGGGCATTTT 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1078851944 11:15171968-15171990 ACATGGCCACAGATGGCCAGGGG 0: 1
1: 1
2: 6
3: 42
4: 355
1078851934_1078851944 27 Left 1078851934 11:15171918-15171940 CCGCTGGATCAAGCACCAATTGT 0: 1
1: 0
2: 2
3: 12
4: 148
Right 1078851944 11:15171968-15171990 ACATGGCCACAGATGGCCAGGGG 0: 1
1: 1
2: 6
3: 42
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078851944 Original CRISPR ACATGGCCACAGATGGCCAG GGG Intronic
900241990 1:1621554-1621576 ACATGGCCTCATCTGTCCAGAGG - Intronic
900737654 1:4309177-4309199 ACATTGCCACAGGTGGCCAGGGG - Intergenic
901791715 1:11656916-11656938 ACATGGTCCCAGAAGGCCAAAGG + Intronic
902159724 1:14520258-14520280 AAATGACCACACATGGCCACAGG + Intergenic
902273354 1:15322542-15322564 AAATGGCCACACGTGGCTAGTGG - Intronic
903624252 1:24720002-24720024 ACAGGGTCAGAGAAGGCCAGAGG - Intergenic
904359480 1:29962670-29962692 GGATGGCCACTGATGGCCAGAGG + Intergenic
904438570 1:30515161-30515183 TCAGGGCCCCACATGGCCAGAGG - Intergenic
905618577 1:39420057-39420079 TCAAAGCCACATATGGCCAGTGG - Intronic
905712788 1:40120878-40120900 AGATAGCCACATGTGGCCAGTGG + Intergenic
907628446 1:56055261-56055283 AAATGACTAGAGATGGCCAGTGG + Intergenic
908249467 1:62253768-62253790 ACAAAGCCAGAGATGGCCAAAGG + Intronic
908748318 1:67396649-67396671 AAATCGCCACACATGGCTAGTGG + Exonic
908790679 1:67778338-67778360 CCATGGCCACACATGGCTAGTGG + Intronic
909173130 1:72319803-72319825 AAATAGCCACACATGGCGAGTGG + Intergenic
909890652 1:81001938-81001960 ACATTGCCACAGAAGGCAACAGG - Intergenic
910290562 1:85596444-85596466 ACATGCACACACATGGTCAGGGG + Intergenic
910519480 1:88102777-88102799 CCATGGTCACAGAAGGACAGAGG + Intergenic
910624769 1:89294369-89294391 ATATGGCCACAGTGGCCCAGTGG + Intergenic
911202496 1:95059829-95059851 ACGTAGCCACATATGGCTAGTGG + Intronic
911552162 1:99296191-99296213 AAGTGGCCACAGGTGGCTAGTGG - Intronic
912065763 1:105740357-105740379 ACAAGACAACAGATGGTCAGAGG - Intergenic
912793414 1:112674992-112675014 ACATGGAGACAGATCGCGAGCGG + Exonic
912958270 1:114171786-114171808 TCATAGCCACACATGGCCAGTGG + Intergenic
915621679 1:157090014-157090036 TCACAGTCACAGATGGCCAGAGG + Intergenic
916758718 1:167797904-167797926 AAATGGCCACATGTAGCCAGTGG - Intergenic
917299066 1:173554216-173554238 ACATGGACACACATGGGCAAGGG - Intronic
917738530 1:177941761-177941783 ACATGGTCAAAGATGGCCGTGGG + Intronic
918115566 1:181493747-181493769 AAATAGCCACATATGGCTAGTGG + Intronic
918333912 1:183488497-183488519 AAATGGCCACATGTGGCCAGTGG - Intronic
921129247 1:212205821-212205843 TGATAGCCACATATGGCCAGTGG + Intergenic
921327185 1:213997793-213997815 ACATTGCCAAAGGTGTCCAGGGG - Exonic
922117644 1:222629877-222629899 ACATGGGCACAGAAAGCCAGGGG + Exonic
922963794 1:229670630-229670652 GAATGGCCACACATGGCTAGCGG - Intergenic
923284304 1:232477078-232477100 ACATGTCCCCAGATTGCAAGTGG + Intronic
924219928 1:241863757-241863779 AAATAGCCACACATGGCTAGTGG - Intronic
1063359908 10:5444310-5444332 ACATAGCTACAGAAGGGCAGTGG + Intronic
1063372613 10:5531721-5531743 ACGTGGACACACATGCCCAGAGG + Intergenic
1063460602 10:6212923-6212945 ACATGGGGACAGAGGGGCAGGGG - Intronic
1064031786 10:11887376-11887398 ACAGGGTCACAGATGGCCCCAGG + Intergenic
1065179641 10:23111969-23111991 AAAAGGCCACATGTGGCCAGAGG + Intronic
1066257805 10:33697147-33697169 GCATGGCCAAATCTGGCCAGTGG + Intergenic
1066654682 10:37686914-37686936 ACATGGCCAGGGATGCACAGGGG + Intergenic
1067178325 10:43966145-43966167 CCAGGGGCACAGCTGGCCAGCGG - Intergenic
1067336812 10:45373564-45373586 CCAGGCCCAGAGATGGCCAGTGG - Intergenic
1067790642 10:49284782-49284804 AGATGGGCACAGACGGCCAAGGG - Intergenic
1068829773 10:61480145-61480167 AAATGGCCACATGTGGCTAGTGG + Intergenic
1069624728 10:69860711-69860733 AAATGGCCGCAGAAGGCCACAGG - Intronic
1070577286 10:77688782-77688804 CCATGGCCACAGGTGGCTAGTGG - Intergenic
1070850220 10:79557257-79557279 AGATGTACACAGATGGGCAGTGG - Exonic
1070857006 10:79614043-79614065 AGATGTACACAGATGGGCAGTGG + Exonic
1075906265 10:126084349-126084371 ACATGGCCTCTGATGGGCTGAGG - Intronic
1077182709 11:1223719-1223741 AGATGCCCACAGATGGGCCGTGG - Intronic
1078518991 11:12048403-12048425 CGATGGCCACATGTGGCCAGTGG + Intergenic
1078851944 11:15171968-15171990 ACATGGCCACAGATGGCCAGGGG + Intronic
1079077004 11:17390260-17390282 AAATGGCCGCAGATGGTCAGGGG - Intergenic
1080395278 11:31884435-31884457 ACATAGCCACACATGGCCAGTGG + Intronic
1080634288 11:34109948-34109970 AAATGCCCACACCTGGCCAGAGG + Intronic
1081510072 11:43761662-43761684 ACTTGGCAGGAGATGGCCAGAGG + Intronic
1081546179 11:44073547-44073569 ACATTGCCACACATCCCCAGGGG - Intronic
1081677288 11:44977826-44977848 ACCGAGCCTCAGATGGCCAGAGG - Intergenic
1081931598 11:46875399-46875421 AGATGGCCCCAGAAAGCCAGAGG + Intronic
1082266190 11:50121133-50121155 ACATGCTCACAGAGGGTCAGGGG + Intergenic
1082289899 11:50357439-50357461 ACATGCTCACAGAGGGTCAGGGG - Intergenic
1082776209 11:57246224-57246246 CCATAGCCACACATGGCAAGTGG - Intergenic
1083413003 11:62506572-62506594 TCAGGGCCCCAGCTGGCCAGAGG + Intronic
1084502575 11:69543649-69543671 ACAGGGCCTCAGATGCCCGGGGG - Intergenic
1084560036 11:69899495-69899517 ACGTGGCCACAGATGGCCTGGGG - Intergenic
1084632855 11:70366592-70366614 CCCTGACCACAGAAGGCCAGTGG - Intronic
1085040516 11:73323867-73323889 ACAAAGACACAGATGCCCAGGGG - Intronic
1085358724 11:75865462-75865484 CAATGGCCACATGTGGCCAGTGG - Intronic
1087606549 11:100384453-100384475 ACATGGGCAGGGGTGGCCAGAGG - Intergenic
1087660841 11:100986331-100986353 ACATGGACATAGCTGGCCTGAGG + Intronic
1088034929 11:105299921-105299943 ACATGGACACAGATGGAAACAGG + Intergenic
1088975571 11:114813343-114813365 CCATGTCCACAGAAGGCCTGAGG + Intergenic
1089345897 11:117791560-117791582 TCATTTCCACTGATGGCCAGGGG + Intronic
1089427301 11:118389276-118389298 TAATAGCCACATATGGCCAGTGG + Intronic
1089574995 11:119435632-119435654 ACATGGCCAAATATCCCCAGGGG - Intergenic
1089965590 11:122652600-122652622 ACATCCTCTCAGATGGCCAGAGG - Intergenic
1090460261 11:126885120-126885142 TGATGCCCACAGATGGCCATGGG + Intronic
1090479620 11:127056589-127056611 ACATGGCCACAGAGGGCGCTGGG + Intergenic
1091451443 12:574769-574791 ACATACCCCCAGAAGGCCAGTGG + Intronic
1091690946 12:2597073-2597095 ACAGGGACACAGATGGACATGGG - Intronic
1091696188 12:2629923-2629945 ACCTGCCCTGAGATGGCCAGAGG + Intronic
1091946944 12:4554852-4554874 ATATAGCCACACATGGCTAGAGG - Intronic
1092094805 12:5832679-5832701 GCATGGACACAGATTCCCAGAGG + Intronic
1093490666 12:19700819-19700841 GCGTGGCCTCAGATGCCCAGCGG + Intronic
1093513182 12:19952868-19952890 GCATGGCCACATGTGGCTAGTGG - Intergenic
1095642770 12:44503409-44503431 TAATAGCCACAAATGGCCAGTGG + Intergenic
1097441282 12:59611880-59611902 ACATGGTCACATATGGCCTTGGG + Intronic
1097688697 12:62714249-62714271 AAATGGCCACATGTGGCTAGTGG + Intronic
1101090509 12:101280264-101280286 TCATGGCTGCAGAGGGCCAGTGG - Exonic
1101303967 12:103508791-103508813 ACAAGGTCACAGTTGGCAAGTGG - Intergenic
1102489432 12:113280609-113280631 AAATTGCCACATGTGGCCAGTGG - Intronic
1102735854 12:115158863-115158885 ACTCGGCCACAGATCTCCAGTGG - Intergenic
1103013835 12:117478787-117478809 ACATAGCCACATCTGGCTAGTGG + Intronic
1103196774 12:119050799-119050821 AAATAGCCACAGATGGCTAGTGG - Intronic
1103403191 12:120657197-120657219 ACATAGCCACATGTGGCTAGCGG + Intronic
1103444333 12:120984375-120984397 ACATGGAATCAGATGGACAGGGG + Intronic
1104002774 12:124870838-124870860 CCATAGCCACATAGGGCCAGTGG - Intronic
1104514105 12:129407920-129407942 AAATGACCACAGATGGACAGTGG + Intronic
1104514320 12:129410207-129410229 AAATGACCACAGAGGGACAGGGG + Intronic
1105941880 13:25154837-25154859 ACAGGGCCTCACATGGCCAGGGG - Intergenic
1106526517 13:30545608-30545630 AAATAGCCACATATGGCTAGTGG - Intronic
1106547800 13:30745381-30745403 AAATGCCCACAGAGGGCAAGGGG - Intronic
1106840362 13:33680208-33680230 ACATCCCCACAGATGGCCATAGG - Intergenic
1108740293 13:53330628-53330650 ACATGGAAACAGAGAGCCAGGGG + Intergenic
1108897852 13:55357440-55357462 ACATGGCATCACATGGCAAGGGG - Intergenic
1109818605 13:67621847-67621869 TCAAAGCCACACATGGCCAGTGG + Intergenic
1112396803 13:99041052-99041074 CTCTGGCCACAGATGTCCAGTGG - Intronic
1112434828 13:99384346-99384368 TCATGGCCCCAGATTGCCACAGG - Intronic
1112813836 13:103250308-103250330 ACATGGGGACAGATGGTCTGAGG - Intergenic
1113697066 13:112354353-112354375 CGGTGGCCACAGAGGGCCAGTGG - Intergenic
1113825413 13:113248957-113248979 CCATGGACACAGAAGGCCAGTGG + Intronic
1115195816 14:30798291-30798313 AAATGGCCACATGTGGCTAGTGG + Intergenic
1117293245 14:54353839-54353861 ACATGGGCACACAAGGGCAGAGG - Intergenic
1117982941 14:61359745-61359767 AAATAGCCACATATGGCTAGTGG - Intronic
1117996513 14:61483126-61483148 GGATGGCCACTGATGGCCTGAGG - Intronic
1119786417 14:77317749-77317771 TCATGGCCAGAAATGGTCAGGGG - Intronic
1120144121 14:80960889-80960911 ACAAGACCGCAGATGTCCAGTGG - Intronic
1121991649 14:98563615-98563637 TGATGGCCACACATGGCTAGTGG - Intergenic
1122337522 14:101003725-101003747 CCATGGTCAGAGATGGCCAGTGG + Intergenic
1122680155 14:103454092-103454114 ACATGGCCAATGAGGGCCACTGG - Intronic
1123717891 15:23043454-23043476 TCATAACCACAGCTGGCCAGAGG + Intergenic
1123718306 15:23044893-23044915 ACATAACCACACCTGGCCAGAGG + Intergenic
1123718308 15:23044903-23044925 ACCTGGCCAGAGGTGCCCAGAGG + Intergenic
1123718572 15:23045823-23045845 TCATAACCACAGTTGGCCAGAGG + Intergenic
1124111195 15:26790259-26790281 ACATTGCCACAGATGCTCCGCGG + Intronic
1124202394 15:27689856-27689878 TCATGGCAGGAGATGGCCAGAGG - Intergenic
1124613020 15:31222082-31222104 CCATGACCACAGGTGCCCAGTGG - Intergenic
1124695591 15:31861930-31861952 CAATGGCAAGAGATGGCCAGTGG + Intronic
1125259643 15:37808603-37808625 AAATGGCCACATGTGGCTAGTGG + Intergenic
1126501434 15:49350299-49350321 AAATGACCACACATGGCTAGTGG + Intronic
1126779835 15:52129968-52129990 ACATGGCCACATCTGGCTACAGG - Intronic
1127644876 15:60947957-60947979 AGATGCCCACAGGTGGCCATAGG - Intronic
1127712230 15:61610984-61611006 ACATTGCCACAGCTGGCCTCTGG - Intergenic
1129994656 15:79994143-79994165 GAAAGGCCACAGGTGGCCAGGGG + Intergenic
1130393774 15:83483468-83483490 AAATGACCACATGTGGCCAGTGG + Intronic
1130649282 15:85752805-85752827 CCATGCCCACAGTTGGCCTGAGG - Intergenic
1130923183 15:88366046-88366068 GCATGGGCACAGAAGGCCTGAGG - Intergenic
1131372328 15:91893227-91893249 ACTTAGCCACATGTGGCCAGTGG + Intronic
1132981293 16:2739812-2739834 ACCTGGCCCCACCTGGCCAGTGG + Intergenic
1133894172 16:9909546-9909568 AAATAGCCACATATGGCTAGTGG + Intronic
1134251107 16:12574806-12574828 AGATGTCCAGACATGGCCAGAGG + Intergenic
1135272374 16:21080549-21080571 CAATGGCCACATGTGGCCAGTGG + Intronic
1135350696 16:21726688-21726710 AGATGGCCACAGATACCCAGAGG - Intronic
1135837560 16:25840869-25840891 ACTTGACCACAGATGGCCCATGG - Intronic
1135875535 16:26196605-26196627 ACATGACCACACATAGCCACAGG + Intergenic
1136170028 16:28483534-28483556 ACAGCTCCACAGATGGCCATTGG + Intronic
1136402311 16:30025307-30025329 ACGTGGGCAGGGATGGCCAGGGG + Exonic
1137564940 16:49527035-49527057 ACATGAACACAGATGGGCTGAGG + Intronic
1137577918 16:49615757-49615779 TCATGGCGACAGAGGCCCAGGGG - Intronic
1138107318 16:54295211-54295233 CCATGGCCACATATGGCTAGTGG - Intergenic
1138179275 16:54931180-54931202 ACATGGCCACACACGGGCATGGG - Exonic
1140513407 16:75524861-75524883 CCGTGGCCACACGTGGCCAGTGG - Intergenic
1141222933 16:82088739-82088761 ATCTTGCCACAGATGGCCAGCGG - Intronic
1142559294 17:800555-800577 ACACGGCCCCGGACGGCCAGAGG - Exonic
1144161623 17:12566091-12566113 AGAAGTCTACAGATGGCCAGAGG + Intergenic
1145064882 17:19755610-19755632 ACCTGGCCACAGCCAGCCAGGGG + Intergenic
1146782742 17:35689690-35689712 ACATAGCCACATGTGGCTAGTGG - Intronic
1148554861 17:48572466-48572488 ACAAGGCTTCAGAGGGCCAGGGG - Intronic
1148736569 17:49868515-49868537 CCCTGCCCACAGCTGGCCAGAGG - Intergenic
1148851324 17:50556859-50556881 ACATAGCCACACATGGTCACTGG + Intergenic
1149155545 17:53624905-53624927 ACATCCCCAGAGATGGCAAGAGG - Intergenic
1149544906 17:57496291-57496313 ACATAGCCACAGATGGCCAAAGG - Intronic
1149908266 17:60546663-60546685 ACATGTCCACCTTTGGCCAGAGG + Intergenic
1150617559 17:66784079-66784101 ACATGGCCCAAGAGGGCCTGTGG - Intronic
1151428211 17:74045007-74045029 CCATGTGCACAGATAGCCAGGGG - Intergenic
1151744165 17:76002629-76002651 ACATGGCCACAGGGTGCCACAGG + Intronic
1152187759 17:78868873-78868895 ACATTGCCACATGTGCCCAGGGG - Intronic
1153545335 18:6199306-6199328 AAATAGCCACATATGGGCAGTGG - Intronic
1155174925 18:23293549-23293571 CCAAAGCCATAGATGGCCAGGGG + Intronic
1155455375 18:26006511-26006533 CGATAGCCACATATGGCCAGTGG - Intergenic
1156360159 18:36377807-36377829 AGAGGGGAACAGATGGCCAGGGG - Intronic
1157016250 18:43718499-43718521 ACAGGGTCACACATGGCGAGGGG + Intergenic
1157201167 18:45661136-45661158 ACATGGCTACAGAAGGCCAGTGG - Intronic
1157286554 18:46381019-46381041 ACACTCCCACACATGGCCAGAGG - Intronic
1158827973 18:61245385-61245407 ACATGCCACCAGATGGCAAGTGG + Intergenic
1158995605 18:62915777-62915799 CAATAGCCACAGACGGCCAGTGG - Intronic
1160227003 18:77019390-77019412 ACACAGCCACAGATGCACAGGGG + Intronic
1160503623 18:79415043-79415065 ACATGGACGCACATGGCCTGTGG - Intronic
1161280097 19:3441397-3441419 ACTTGTCAACTGATGGCCAGGGG - Intronic
1163557414 19:18000712-18000734 ACAAGGCCAGAGGTGGCAAGGGG + Intergenic
1163742073 19:19021277-19021299 ACATGGACACAGACGGGCACAGG - Intronic
1164582228 19:29441775-29441797 ACCTGGGCACAGTTGGCCTGAGG - Intergenic
1164590524 19:29504479-29504501 CCAGGGCCACAGCTGGCCACAGG - Intergenic
1166874292 19:45887827-45887849 CCAAGGCCACAGCTGGTCAGAGG - Intergenic
1167277565 19:48548025-48548047 AAATAGCCACCTATGGCCAGTGG + Intergenic
1167356952 19:49010248-49010270 GCATGGCCACATGTGGCCTGTGG + Intronic
1167360011 19:49024986-49025008 ACATGCAAGCAGATGGCCAGGGG - Intronic
1167361072 19:49030785-49030807 ACATGCAAGCAGATGGCCAGGGG + Intronic
1167362579 19:49038012-49038034 ACATGCAAGCAGATGGCCAGGGG - Intergenic
1167363552 19:49043172-49043194 ACATGCAAGCAGATGGCCAGGGG + Intergenic
926657814 2:15428319-15428341 AAATAGCCACATGTGGCCAGTGG + Intronic
929054074 2:37861114-37861136 ACATGACCTCAGTTGGCCATAGG + Intergenic
929122051 2:38491424-38491446 ACATTGCCACAGCTGTGCAGAGG - Intergenic
929136026 2:38624624-38624646 TCATGGGGACAGATGTCCAGTGG + Intergenic
929884534 2:45866678-45866700 AAATAGCCACAGGTGGCTAGTGG - Intronic
930766559 2:55091101-55091123 AAAAGGCCACTGGTGGCCAGAGG - Intronic
932817035 2:74870333-74870355 ACATAGCCACAGATGGCCAGTGG + Intronic
933461742 2:82596786-82596808 ACATGGTCATACATGCCCAGGGG - Intergenic
934680336 2:96279043-96279065 ACACGGTCACAGAGGGCCAAGGG + Intronic
935239350 2:101164943-101164965 AAATAGCCACACATGGCTAGTGG - Intronic
936703241 2:115039064-115039086 ACATGGACAGAGAAGGACAGTGG + Intronic
936765045 2:115837009-115837031 GTATGGCCACAAGTGGCCAGTGG - Intronic
937204110 2:120224627-120224649 CCAGGGCCACAGATTGCCTGTGG - Intergenic
937292695 2:120791060-120791082 ACATGGCCACAGACACACAGTGG + Intronic
937710329 2:124973544-124973566 TCTTGGCCACAGAGGGCAAGGGG + Intergenic
938159600 2:128973461-128973483 ACATGGCCACAGAGGCCCTGGGG - Intergenic
938324101 2:130386118-130386140 AAATAGCCACACATGGCTAGTGG - Intergenic
938698495 2:133855682-133855704 TCCTGGCTAGAGATGGCCAGTGG - Intergenic
939556453 2:143679959-143679981 ACATTCTCACAGAAGGCCAGGGG + Intronic
940858006 2:158744857-158744879 AAATAGCCACATATGGCCAGTGG + Intergenic
941400842 2:165028971-165028993 CAATGGCCACACATGGCCAGTGG + Intergenic
943601632 2:189927789-189927811 AAATAGCCACATATGGCTAGTGG - Intronic
944510184 2:200456743-200456765 GCATGTCCTCAGATGCCCAGTGG - Intronic
945589345 2:211710505-211710527 AAATGGACTCAGAAGGCCAGTGG + Intronic
945633658 2:212318913-212318935 CCATGGCTACAGAGAGCCAGTGG + Intronic
946062528 2:216956391-216956413 ACATAGACACAGATAACCAGAGG + Intergenic
947434479 2:230061073-230061095 CCATGGCCATAGCTGGGCAGTGG - Intronic
947752832 2:232541655-232541677 AGATGGGCACAGAGGCCCAGGGG - Intronic
948116780 2:235499151-235499173 ACACGGCGACAGAGGGCCAGAGG - Intronic
948146388 2:235711243-235711265 AAATAGCCACACAGGGCCAGCGG + Intronic
1170785655 20:19465091-19465113 AGATAGCCACATGTGGCCAGTGG + Intronic
1171009304 20:21499561-21499583 AAATAGCCACATGTGGCCAGTGG - Intergenic
1171092096 20:22294927-22294949 AAATGGCCACAGGTGACTAGTGG + Intergenic
1172217466 20:33246360-33246382 TCATATCCAGAGATGGCCAGGGG - Intergenic
1172297366 20:33822595-33822617 ACAAGGCCACAGAAGGCTATCGG - Intronic
1173010906 20:39181195-39181217 ACATGGGGAGAGATGGCAAGAGG - Intergenic
1173248290 20:41350929-41350951 AAATAGCCACATATAGCCAGTGG - Intronic
1173342623 20:42166425-42166447 AAATAGCCACAGGTGGCCAGTGG + Intronic
1173484746 20:43432642-43432664 ACATTGCCAGACATCGCCAGGGG - Intergenic
1173530963 20:43769268-43769290 AGGTGCACACAGATGGCCAGAGG - Intergenic
1173580284 20:44142328-44142350 AAATGGCCACAGGTTGCTAGTGG + Intronic
1174620538 20:51871152-51871174 AAATAGCCACATATGGCTAGTGG - Intergenic
1174725475 20:52857134-52857156 AAATGGCCACATGTGGCTAGCGG - Intergenic
1175711334 20:61223566-61223588 AAATGCCCACACATGGCTAGTGG + Intergenic
1175867254 20:62185777-62185799 AAATGGCCACATTTGGCCAGTGG + Intronic
1175913332 20:62414761-62414783 ACCTGGCCAGAGGTGGCCTGTGG + Intronic
1176180796 20:63748442-63748464 ACATGGCCAGGGATGGGGAGAGG + Intronic
1176913919 21:14602313-14602335 TCAGGGACACAGATGGTCAGCGG - Intronic
1177608094 21:23408188-23408210 ACAGGGGCACACATGGCCAGAGG + Intergenic
1178114055 21:29398861-29398883 ACTTTGCCACAGATGGCCACAGG + Intronic
1178385763 21:32149015-32149037 ACATTGCCACTGAAGGACAGGGG + Intergenic
1179285002 21:39969718-39969740 ACATGGAGGCAGATGTCCAGGGG - Intergenic
1179298124 21:40081473-40081495 CTATGGCCACAGAAGGCCAGTGG - Intronic
1179943700 21:44656013-44656035 ACATGGCCACAGATCGGCTCTGG - Intronic
1179946948 21:44685024-44685046 ACATGGCCACAGATCGGCTCTGG + Intronic
1181175424 22:21032283-21032305 ACCTGGCCACAGACAGACAGTGG + Intronic
1181868086 22:25875151-25875173 ACATGAGCACAGAAGGCCAGTGG - Intronic
1182124226 22:27804768-27804790 ACACGGGCACAGATGGGCACAGG - Intergenic
1183263585 22:36811921-36811943 AGCTGGCATCAGATGGCCAGGGG + Intronic
1183284251 22:36952490-36952512 CCCTGGCCACAGATGGGGAGTGG - Intergenic
1184333821 22:43841671-43841693 AGATAGCCCCAGATAGCCAGGGG - Intronic
949207862 3:1461758-1461780 CAATAGCCACAGGTGGCCAGAGG + Intergenic
949941762 3:9160082-9160104 CCAAGGCCACAGGTAGCCAGTGG - Intronic
950145833 3:10649049-10649071 AAATGGCCACATGTGGCTAGTGG - Intronic
950174514 3:10863493-10863515 ACATGCACACAGAGTGCCAGAGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950495687 3:13333044-13333066 ACATGGCCAGAGCCAGCCAGAGG - Intronic
950936507 3:16844717-16844739 ACCTGGCCACATGTGGCCATTGG - Intronic
951705846 3:25543590-25543612 AAATGGCCACAGATGGCCAATGG - Intronic
951707159 3:25554840-25554862 ACAGGGCCTCATATGGCAAGAGG + Intronic
952023531 3:29051808-29051830 ACATGGACACGGCTGGGCAGGGG - Intergenic
952529134 3:34245133-34245155 AAATGGCCACAAATGACCAGTGG - Intergenic
952761229 3:36916199-36916221 ACATAGCCACATGTGGCTAGTGG + Intronic
952927357 3:38329857-38329879 AAATGGCCACATGTGGCTAGTGG + Intergenic
953496605 3:43393007-43393029 AAATAGGCACAGATGGCCACAGG + Intronic
953789968 3:45939810-45939832 ATATAGCCACATATGGCTAGTGG - Intronic
954077460 3:48191237-48191259 AGGTGGCCACAGAAGGCCATGGG + Intergenic
954083023 3:48223584-48223606 ACCTGGGCAATGATGGCCAGAGG - Exonic
954727820 3:52630381-52630403 AAATAGCCACACATGGCTAGTGG - Intronic
955212324 3:56953750-56953772 AAATGGCCACACATTTCCAGAGG - Intronic
959162102 3:102736109-102736131 ACGTGGCCGCAGATGGGCTGTGG + Intergenic
959935171 3:112021668-112021690 ACATGGCCAGAGGGAGCCAGAGG - Intergenic
960570709 3:119182714-119182736 AAATGGCCACAGATGTCAAGAGG - Intronic
960807404 3:121597505-121597527 ACATGGCTACAGGAGGGCAGTGG + Intronic
961055414 3:123784196-123784218 ACATGGCCACACTGGCCCAGAGG - Intronic
961635487 3:128330272-128330294 AGGTCGCCACAGATGGTCAGGGG + Intronic
964400198 3:156290646-156290668 AGGTGGCCACAGATGATCAGTGG + Intronic
966781058 3:183584502-183584524 CTATTGCCAGAGATGGCCAGAGG - Intergenic
967062110 3:185881687-185881709 AGATGGTCAGAGAGGGCCAGAGG + Intergenic
969036659 4:4259343-4259365 TCATGGCCACAGATGCCAAAAGG + Intergenic
969038189 4:4273045-4273067 ACAGGCCCAGAGATGGGCAGGGG + Intronic
969313704 4:6369141-6369163 AAATAGCCACATGTGGCCAGTGG - Intronic
970020661 4:11564006-11564028 ATATGGCCACATGTGGCTAGGGG + Intergenic
970078746 4:12255240-12255262 ACATTTGCACAGATGGCCAGGGG - Intergenic
970901758 4:21167651-21167673 AAGTGGCTACTGATGGCCAGTGG - Intronic
971737468 4:30474296-30474318 AGAAGGCTACAGATGGCCTGAGG + Intergenic
971928634 4:33048722-33048744 ACATGGCCTCACATGGCAAGGGG - Intergenic
972914919 4:43864803-43864825 AAATGGCCACACGTGGCTAGTGG + Intergenic
973325215 4:48853634-48853656 AAATAGCCACATATGGCTAGCGG - Intronic
975858786 4:78653874-78653896 ACGTGGCCACAGTTAGCCACAGG + Intergenic
977481368 4:97581095-97581117 AAATAGCCACAAATGGCTAGTGG - Intronic
978327019 4:107570553-107570575 ACATAGCTACATATGGCTAGGGG - Intergenic
978709047 4:111755129-111755151 ACATGGCCCCAGAACTCCAGTGG + Intergenic
978718946 4:111882395-111882417 TCATAGCCACATGTGGCCAGTGG - Intergenic
979946571 4:126839974-126839996 ACATTGGCAAAGATGACCAGTGG - Intergenic
979967133 4:127088682-127088704 ACATGGGCAGGGGTGGCCAGAGG - Intergenic
980520741 4:133930342-133930364 AAATAGCCACATATGGCTAGTGG - Intergenic
981124517 4:141090653-141090675 TCATGGCCTCAGATGGCTACAGG + Intronic
981256172 4:142662286-142662308 ACATGACCACACATGTGCAGTGG - Intronic
982118898 4:152120309-152120331 ACAGGGCATCACATGGCCAGGGG - Intergenic
984880834 4:184408793-184408815 GCAGGGCCTCAGGTGGCCAGAGG - Intronic
985729533 5:1539562-1539584 ACAGGGCCACACAGGGCCATAGG + Intergenic
986351515 5:6884726-6884748 ACATGGCCACACCTTGTCAGAGG + Intergenic
987296026 5:16552065-16552087 ACATGACCTCAGATGGCAGGAGG - Intronic
989564420 5:42887593-42887615 AAATAGCCACATATGGCTAGGGG - Intergenic
994212607 5:97103051-97103073 ACAAGCTCACAGATGGCAAGTGG + Exonic
996541439 5:124633438-124633460 ACATGACAACAGCTGGCCAAGGG + Intergenic
997294343 5:132760431-132760453 ACAGGGCCACAGCTGCCAAGGGG + Intronic
997681861 5:135762175-135762197 AAATGGCCGCACGTGGCCAGTGG + Intergenic
997842671 5:137256477-137256499 ACATGGTGACAGAGGGCAAGAGG + Intronic
998013376 5:138713190-138713212 AGATAGCCACACATGGCCAGTGG - Intronic
998564768 5:143207225-143207247 ACATGGGCCAAGATGGCGAGAGG - Exonic
999907013 5:156152432-156152454 TAATTGCCACACATGGCCAGTGG - Intronic
1000141982 5:158414198-158414220 AAATAGCCACATATGGCTAGGGG - Intergenic
1000244662 5:159439424-159439446 ACAAGGAGACAGTTGGCCAGTGG + Intergenic
1000649202 5:163795214-163795236 CCATAGCCACACATGGCCAGTGG - Intergenic
1000748667 5:165067542-165067564 ACATGGCCCCAAATGTCCATAGG - Intergenic
1001596753 5:172903377-172903399 ACATGTCCACTGAGGGCCACCGG + Intronic
1001704480 5:173731859-173731881 CCATGGCCACATGTGGCCAGTGG - Intergenic
1001744182 5:174078014-174078036 ATATAGCCACAGGTGGCTAGGGG - Intronic
1002472809 5:179447255-179447277 ACTTGGCCACGGCTGGCCGGAGG - Intergenic
1002481413 5:179503407-179503429 ACTTGGCCACGGCTGGCCGGAGG + Intergenic
1002704264 5:181149455-181149477 GCATCCCCCCAGATGGCCAGTGG - Intergenic
1003410374 6:5856651-5856673 ACATGTCTACAGATGGGCAGGGG + Intergenic
1003924957 6:10869097-10869119 ATATTACCACATATGGCCAGTGG + Intronic
1004012402 6:11702316-11702338 ACATGGTCTCATATGGCTAGTGG - Intergenic
1004306551 6:14506553-14506575 AAATGGCCACATATGGCTAGTGG + Intergenic
1006615213 6:35321454-35321476 ACCTGGCCACAGCTGGCCTGTGG + Exonic
1007256601 6:40534080-40534102 ACAGGGACACAGCTGGTCAGTGG + Intronic
1007712649 6:43834582-43834604 AAATGGCCACATGTGGCTAGTGG + Intergenic
1007811006 6:44485652-44485674 ACAGGGAGACAGATGGACAGGGG + Intergenic
1010188693 6:73171632-73171654 CGATAGCCACAGGTGGCCAGTGG + Intronic
1011323120 6:86119074-86119096 ACATGGCCACAGATGTGAACGGG - Intergenic
1011985071 6:93433192-93433214 ACATGGCATCAGATGGCAGGAGG - Intergenic
1015581322 6:134728739-134728761 ATGGTGCCACAGATGGCCAGGGG - Intergenic
1017033404 6:150244598-150244620 CCATAGCCACAGATGGCTAGTGG - Intronic
1017216369 6:151911950-151911972 AAATGGCCACATGTGGCTAGTGG - Intronic
1018798804 6:167207210-167207232 CCATGGTCAGAGGTGGCCAGTGG + Intergenic
1019033422 6:169033470-169033492 ACATGGCCAGACATCCCCAGTGG + Intergenic
1019518570 7:1450421-1450443 ACAGGACCACAGGTGGGCAGAGG + Intronic
1021250354 7:18317703-18317725 ACAATTCCACAGGTGGCCAGAGG - Intronic
1023414524 7:39919585-39919607 AAATAGCCACACATGGCTAGTGG + Intergenic
1024132151 7:46364054-46364076 ACATGGCTACAGGTGACCATAGG - Intergenic
1025003888 7:55340728-55340750 GCAGGGCCACAGTTGTCCAGAGG + Intergenic
1026462099 7:70623439-70623461 AAATAGCCACAGGTGGCTAGTGG - Intronic
1028971379 7:96862534-96862556 AAATAGCCACAGGTGGCTAGCGG + Intergenic
1029199855 7:98831847-98831869 AAATGGCCACATCTGGTCAGTGG - Intergenic
1029520876 7:101061414-101061436 CCATGGCCACAGATGCCTATGGG - Intergenic
1029710094 7:102294756-102294778 ACCTGGCTACAGATGGAGAGAGG - Intronic
1030679897 7:112423734-112423756 CCATGGCCACAAAGGGCCAGAGG - Intronic
1031954921 7:127933087-127933109 ACATGGCCACAAATGTATAGGGG + Intronic
1032434556 7:131889445-131889467 CCATGGCCACATGTGGCTAGTGG + Intergenic
1032543311 7:132722226-132722248 ACATGGCCACTGGAGGCCTGGGG + Intronic
1034000815 7:147410643-147410665 AAATAGCCACATATGGCTAGTGG - Intronic
1034255236 7:149721150-149721172 ACATGCCCATAGCTGGCGAGAGG + Intronic
1034466159 7:151230463-151230485 CCATAGCCACATATGGCCGGAGG - Intergenic
1034541186 7:151759271-151759293 ACATGGAGACATTTGGCCAGTGG - Intronic
1035337017 7:158136234-158136256 AGATGGCCACATGTGGCCAGAGG + Intronic
1035543829 8:463487-463509 ACTTGTCCTCAGATGGGCAGAGG - Intronic
1036638910 8:10569866-10569888 ACATGGAGACAGGTGGCCACAGG + Intergenic
1036792506 8:11730817-11730839 CCAAGGCCACAGAAGGCCCGAGG + Intronic
1038061079 8:23913656-23913678 ACGTAGCCACAGGTGGCCAGTGG - Intergenic
1041778754 8:61554607-61554629 CAATGGCCACATGTGGCCAGTGG + Intronic
1043483784 8:80678962-80678984 GCCTGGCCACAGGTGGGCAGTGG + Intronic
1047224824 8:122947464-122947486 AAAAGGCCACATGTGGCCAGTGG + Intronic
1050831028 9:10013216-10013238 ACAAGGCCACAGATGGACACTGG + Intronic
1051339011 9:16093955-16093977 ACAAAGCCACACATGGCCAACGG - Intergenic
1052445795 9:28559532-28559554 ACATGGCCACTGACGGCCTTTGG + Intronic
1053555705 9:39134860-39134882 ACATGGCCAAAAATGGCATGTGG - Intronic
1053819823 9:41955118-41955140 ACATGGCCAAAAATGGCATGTGG - Intronic
1054110089 9:61098777-61098799 ACATGGCCAAAAATGGCATGTGG - Intergenic
1054610768 9:67232348-67232370 ACATGGCCAAAAATGGCATGTGG + Intergenic
1056279514 9:85027687-85027709 AAATAGCCACATATGGCTAGTGG + Intergenic
1056316542 9:85395864-85395886 ACATGGCCTCAGATGGAAGGTGG + Intergenic
1056998403 9:91485078-91485100 AAATAGCCACAGATGGCTGGTGG - Intergenic
1057006444 9:91564948-91564970 AAAGGCCCAGAGATGGCCAGAGG + Intronic
1057583702 9:96310569-96310591 AAATAACCACATATGGCCAGTGG - Intergenic
1058888032 9:109337687-109337709 AAATAGCCACAGGTGGCTAGTGG - Intergenic
1059245898 9:112849306-112849328 AAATAGCCACATATGGCTAGTGG - Intronic
1059423272 9:114205858-114205880 AGATGGCCACAGGTGCCCCGAGG + Intronic
1060822174 9:126667777-126667799 GGATGGCCAAAGGTGGCCAGTGG + Intronic
1060897537 9:127226993-127227015 GCATGGCCACAGGTGCCTAGAGG - Intronic
1061283401 9:129609779-129609801 AAGTGGCTACAGAGGGCCAGGGG + Intronic
1061505156 9:131027657-131027679 ACTTAGCCACATGTGGCCAGTGG + Intronic
1062197038 9:135280103-135280125 TCATGGCTACAGGTGGGCAGAGG - Intergenic
1062357550 9:136171940-136171962 ACAGAGCCACAGCTGGGCAGAGG + Intergenic
1062471428 9:136707245-136707267 ACCTGCCCACAGGTGGCCAGTGG - Intergenic
1062708667 9:137959973-137959995 TCATGGCCATAGAAGGCCTGAGG + Intronic
1186501922 X:10058127-10058149 GTAGGGCCACAGATGGGCAGGGG - Intronic
1186517495 X:10176824-10176846 ACCTGGCCACTGCTGGGCAGAGG + Intronic
1186593258 X:10953400-10953422 ACATGGGCAGGGATGGCCGGAGG - Intergenic
1188694299 X:33170732-33170754 CAATGGCCATAGATGGCAAGTGG + Intronic
1191938272 X:66449357-66449379 GCATGGACAGAGATGGACAGAGG - Intergenic
1192493549 X:71597554-71597576 AGAGGGCCACAGATGGAGAGAGG - Intronic
1194573914 X:95587641-95587663 AGAAGGCCAGAGATGGGCAGTGG - Intergenic
1196011543 X:110893156-110893178 AAATAGCCACACATGGCTAGTGG - Intergenic
1196038536 X:111174633-111174655 CCATAGCCACACATAGCCAGTGG - Intronic
1199975368 X:152892070-152892092 AAATAGCCACATGTGGCCAGTGG + Intergenic
1200690418 Y:6303268-6303290 ACATAGCCGCAGATGTCGAGAGG - Intergenic
1200810917 Y:7483884-7483906 AATTAGCCACAGATGGCTAGAGG - Intergenic
1201044855 Y:9871448-9871470 ACATAGCCGCAGATGTCGAGAGG + Intergenic
1201910708 Y:19130894-19130916 GAAAGGCAACAGATGGCCAGTGG - Intergenic