ID: 1078853483

View in Genome Browser
Species Human (GRCh38)
Location 11:15186592-15186614
Sequence TGGGAAAATACCTCCTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078853483 Original CRISPR TGGGAAAATACCTCCTAAGT GGG (reversed) Intronic
915658017 1:157377574-157377596 TGGGATAATACCTCCTCTGCAGG - Intergenic
918125646 1:181580995-181581017 TAGGAAATTACATCCTATGTTGG + Intronic
921413245 1:214859239-214859261 TGGAAAAATACCTTTTAAATAGG + Intergenic
922673844 1:227538210-227538232 TGGGCAAATTATTCCTAAGTGGG + Intergenic
1063579239 10:7290918-7290940 TGGGAAAATACCACTAATGTTGG + Intronic
1063737518 10:8777136-8777158 TGGGTAAACACCTAGTAAGTGGG - Intergenic
1064385892 10:14891195-14891217 TGGGAAAGGCCCTCCTAATTAGG + Intronic
1068476047 10:57527170-57527192 TTGGAAAATACATCATGAGTTGG - Intergenic
1069731237 10:70615934-70615956 TGAGAACATTCCTCCAAAGTGGG + Intergenic
1074231170 10:111537349-111537371 TGGGAAAATACCTTGTATTTGGG + Intergenic
1074247669 10:111711499-111711521 TGGGAAAATAACCCATAAGTAGG + Intergenic
1078853483 11:15186592-15186614 TGGGAAAATACCTCCTAAGTGGG - Intronic
1079942056 11:26693236-26693258 TGGGAAAATCCATGCAAAGTGGG + Intronic
1081408115 11:42721797-42721819 TGGGAAGAGACCTCCCAAGAAGG - Intergenic
1082858369 11:57829642-57829664 GGGAAAAATGTCTCCTAAGTGGG - Intergenic
1090655619 11:128842175-128842197 TGGGAAAAAAACTCAGAAGTTGG - Intronic
1095680656 12:44971611-44971633 TGAGAAAATAGCTCTTAAGGGGG - Intergenic
1097771311 12:63589519-63589541 TGGGACAATACCTCATTAGAGGG + Intronic
1100910478 12:99355744-99355766 TGGGTAAATAGTTCTTAAGTAGG - Intronic
1101487180 12:105176731-105176753 TCAGATAATACCTCCTAAGAAGG - Intronic
1108103504 13:46983533-46983555 TGGGAAAATCCCTTCTCATTTGG - Intergenic
1108211002 13:48139693-48139715 AGGGAAAATTCCGCCTAAATAGG + Intergenic
1111867237 13:93784442-93784464 TTGGAAAATACCTACTCAGCTGG - Intronic
1124839243 15:33226465-33226487 TGGGAAAATTCCTTCTATGTAGG - Intergenic
1126714358 15:51498422-51498444 AGGGAAAAGACCTCCTTAATAGG - Intronic
1129079349 15:73025424-73025446 TGGGACATTATCTCCTCAGTTGG - Intergenic
1134106866 16:11491739-11491761 TGGGCAAACACCTCCTCACTGGG + Exonic
1138706560 16:58921127-58921149 TGGGAAAATGCCTCCTCAAGGGG - Intergenic
1139739967 16:69026841-69026863 AGGGAAAATTCCCCCTCAGTAGG - Intronic
1141719730 16:85749774-85749796 TGGGAAAATACACTCTACGTGGG + Intronic
1146283806 17:31561014-31561036 TGGGAAAATGCCTCTTGAATGGG - Intergenic
1146682451 17:34817845-34817867 GGGGAAAATGCCTTCTAAGCTGG + Intergenic
1150282136 17:63934826-63934848 TGGGAAAAGACCTGCTAAGAAGG + Intergenic
1151523891 17:74650545-74650567 TGGGAATAAAACTCCTAAGATGG - Intergenic
1153261586 18:3229496-3229518 TGGGCAAATACTTCCCAAGGAGG - Intergenic
1159024544 18:63170615-63170637 TGGGAGAAGAACTCCAAAGTGGG - Intronic
1159889811 18:73943015-73943037 TGGGGAAATCCATCCTAATTAGG - Intergenic
1164709849 19:30347922-30347944 TAGGAGAAGACATCCTAAGTAGG - Intronic
1166596461 19:44054388-44054410 TGGGAAAATACATTATTAGTGGG + Intronic
1168381577 19:55928116-55928138 GGGGAAGATACCTCTCAAGTAGG - Intronic
925078365 2:1039516-1039538 TTTGAAAATGCCCCCTAAGTAGG + Intronic
927591706 2:24362302-24362324 TTGGTAAATTCCTCCTAAGCTGG - Intergenic
930770972 2:55130353-55130375 TGGAAAAATACATACTAAGATGG + Intergenic
932541529 2:72659633-72659655 TTGGAAAATGGCTCCTAAGCTGG + Intronic
932866634 2:75350078-75350100 TGAGTACATACCTACTAAGTTGG + Intergenic
939963635 2:148588937-148588959 TGAGAAAATACATCATAAGTAGG + Intergenic
940599110 2:155835131-155835153 TGGGAAAATACCTGCAAAAGAGG + Intergenic
943664411 2:190593774-190593796 TGGAAAAATACCTCCCAACTGGG - Intergenic
944106151 2:196081917-196081939 TGGGGAAATAGATTCTAAGTGGG - Intergenic
944583626 2:201154573-201154595 TGGAAGAATACCTGCTATGTAGG + Intronic
1169028365 20:2388436-2388458 TGGGAATCTGCCTCCTGAGTTGG - Intronic
1172467798 20:35169400-35169422 TGGGATAATACCTCCCCAGCCGG + Intergenic
1173403506 20:42745263-42745285 TGGGAAGATACTTCCTCTGTGGG - Intronic
1179956948 21:44746267-44746289 TGGAAAAATCCCACCTAAGCAGG + Intergenic
1182166597 22:28180732-28180754 AGGGAAAAAACTTCCTGAGTGGG + Intronic
1182604474 22:31492471-31492493 TGGAAAAGTAGGTCCTAAGTAGG - Intronic
949130838 3:498708-498730 TAGGAAAAGACCCCCTAAGGAGG + Intergenic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
952287675 3:31983819-31983841 TTGGAAAATACATAATAAGTTGG + Intronic
954377454 3:50202627-50202649 TGGGAAAATGCCTGCGAGGTTGG - Intergenic
958586312 3:96091881-96091903 TGGGGAAATACCTCCCAACAGGG + Intergenic
959006056 3:101021186-101021208 AGGGAAAATATGTCCTATGTGGG - Intergenic
960632377 3:119745029-119745051 TAGGAAGATACCTTCTAAATGGG + Intronic
965303845 3:167039028-167039050 TGAGAAAACATCCCCTAAGTTGG + Intergenic
967347169 3:188470445-188470467 TGGGAAAATATTTCCTGAGTGGG - Intronic
968409056 4:370500-370522 AGGAAAAATAGCTTCTAAGTAGG - Intronic
969036248 4:4256267-4256289 TGAGAAAATACCTACTTTGTCGG + Intergenic
971166581 4:24190017-24190039 TGGGAGATAACCTCCTTAGTAGG - Intergenic
972070299 4:35011157-35011179 TGGTTAAATAGGTCCTAAGTGGG + Intergenic
975179441 4:71327472-71327494 AGGGAAAATGCATCCTAAGAAGG - Intronic
975328956 4:73091874-73091896 TGGAAAAGTACCTCCAAAGTGGG + Exonic
976693863 4:87897562-87897584 TGGGAAAATACTTTCTGGGTAGG - Intergenic
977266889 4:94866162-94866184 TGGTGACATAACTCCTAAGTAGG - Intronic
977382918 4:96299752-96299774 TTGGAAAATTCCTCAAAAGTAGG + Intergenic
980004626 4:127527775-127527797 TGAGAATAAACCTCCTAAGTTGG + Intergenic
987424694 5:17759227-17759249 TGGGAAAAAACGACCTAAGGAGG - Intergenic
989461069 5:41698513-41698535 AGGGAAAATACTTCCCAAATTGG + Intergenic
993205737 5:84875884-84875906 TTGCAAAATTCCTCCTAATTAGG - Intergenic
993788368 5:92173632-92173654 GGAGAAAATACCTCCTACTTGGG - Intergenic
996033680 5:118734277-118734299 TGGGTAAATACATTCTAAATGGG - Intergenic
996340823 5:122437247-122437269 TCTGAAAATACCTCCTAAGAAGG - Intronic
996403744 5:123088091-123088113 TGGGAAAGTACCTCCTGAGTCGG + Intergenic
1000119060 5:158179426-158179448 TAGGATAATACCTCCGCAGTGGG + Intergenic
1000813776 5:165894302-165894324 TGGCAAAGTCCCTCCTAAGAGGG - Intergenic
1001044481 5:168361364-168361386 TAGGAAATTACCTTCCAAGTAGG + Intronic
1002542862 5:179917640-179917662 GGGGGAAATCCCTGCTAAGTCGG - Intronic
1002761804 6:208310-208332 TGGGAAAATACCCCCTGGGCAGG + Intergenic
1005577934 6:27207529-27207551 TGGGAAAATAACTACAGAGTAGG - Intergenic
1006250675 6:32780889-32780911 TGGGAATTTAATTCCTAAGTGGG - Intergenic
1008423067 6:51325213-51325235 TGAGAAAATCTCTCCTATGTGGG - Intergenic
1014514981 6:122366770-122366792 TGGGAGAATATCTCCTGGGTGGG + Intergenic
1020859342 7:13470854-13470876 TGGTAAAATACTTTATAAGTTGG + Intergenic
1020937023 7:14479047-14479069 TGGGAAAATATCTCCACACTTGG - Intronic
1022692141 7:32667011-32667033 TGGAAAAATACTTCCTAAATTGG + Intergenic
1022919765 7:35001249-35001271 TGGAAAAATACTTCCTAAATTGG + Intronic
1022930910 7:35113297-35113319 TGGGACAATACCTCATTAGAGGG + Intergenic
1027864495 7:83629246-83629268 TGGGAAGATACCTCCCAACAGGG - Intronic
1029065764 7:97846740-97846762 TGTCAAAATTGCTCCTAAGTAGG + Intergenic
1032204617 7:129851065-129851087 TGGGAAATTACCTTTTAAGCGGG - Intronic
1033280164 7:140000895-140000917 CTGGAAAGTACCTCCTAAGCAGG - Intronic
1033865063 7:145680202-145680224 TGGGAAATTACCAACTAAGATGG + Intergenic
1038977845 8:32721092-32721114 TTAGAAAATGCTTCCTAAGTGGG - Intronic
1040655437 8:49502161-49502183 TGAGAAACTTCCTCATAAGTAGG - Intergenic
1042384311 8:68155011-68155033 TGGGAAAAGTCCTTCTAGGTGGG + Intronic
1043753362 8:83969667-83969689 TGGGAAAATACTTCCTAGAGGGG - Intergenic
1044937575 8:97308041-97308063 TGGGACTATACCTCCTAGGCTGG + Intergenic
1047998120 8:130356591-130356613 TGGAGAAATACCACCTAACTAGG - Intronic
1048616911 8:136085080-136085102 TTGAAGAATATCTCCTAAGTTGG + Intergenic
1050067547 9:1776394-1776416 TGGGAAAATAGCTACAGAGTCGG + Intergenic
1051686844 9:19666817-19666839 TGGTAAACTGCTTCCTAAGTGGG + Intronic
1055430898 9:76242683-76242705 TGGGAAAATACATCTGAAATGGG - Intronic
1057392146 9:94648851-94648873 TGGCTAAACACCTCCTCAGTGGG - Intergenic
1059538472 9:115106874-115106896 AGGGAAAATTCCTTCTAAATAGG + Intronic
1185967258 X:4620989-4621011 TAGGAAAATATCTCCTAAGTGGG - Intergenic
1186228769 X:7429880-7429902 TGGGAAAACATCTGCAAAGTGGG + Intergenic
1188206868 X:27370717-27370739 TGGGCAATTACCTATTAAGTAGG - Intergenic
1189236018 X:39488062-39488084 TGGAAAAATGCCTCCGAAGCAGG - Intergenic
1190431823 X:50385384-50385406 TAGGAAAATACCTCCCTGGTAGG - Intronic
1192937589 X:75876717-75876739 TGGGCAAAGACTTCATAAGTAGG - Intergenic
1193341238 X:80352085-80352107 TGGGAGAATACCTCCCAACAAGG - Intronic
1200640344 Y:5709715-5709737 GGGGAAACTATCTCCTCAGTTGG + Intronic