ID: 1078854322

View in Genome Browser
Species Human (GRCh38)
Location 11:15194397-15194419
Sequence GTGCCCTACCCAAGATTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078854315_1078854322 28 Left 1078854315 11:15194346-15194368 CCCACTCGGTATCGCAGTCCCTC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG 0: 1
1: 0
2: 1
3: 6
4: 118
1078854316_1078854322 27 Left 1078854316 11:15194347-15194369 CCACTCGGTATCGCAGTCCCTCA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG 0: 1
1: 0
2: 1
3: 6
4: 118
1078854318_1078854322 10 Left 1078854318 11:15194364-15194386 CCCTCAGAGAGTTTGTGGAAAAC 0: 1
1: 0
2: 2
3: 22
4: 175
Right 1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG 0: 1
1: 0
2: 1
3: 6
4: 118
1078854319_1078854322 9 Left 1078854319 11:15194365-15194387 CCTCAGAGAGTTTGTGGAAAACC 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG 0: 1
1: 0
2: 1
3: 6
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078854322 Original CRISPR GTGCCCTACCCAAGATTCCA TGG Intronic
902096457 1:13949994-13950016 GGCCCCTACCCACCATTCCAAGG - Intergenic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
907368660 1:53982929-53982951 GTGCCCTATCCAATACCCCATGG - Intergenic
911162213 1:94692442-94692464 ATAACTTACCCAAGATTCCATGG - Intergenic
915559488 1:156678190-156678212 GTCCACTACCCAACATTCCCTGG - Intergenic
922034511 1:221835432-221835454 GAGCCCTCCCACAGATTCCAGGG + Intergenic
1063535227 10:6876698-6876720 GTGCCCTCCCCCTGTTTCCAGGG - Intergenic
1065440077 10:25744007-25744029 AAGCTCTACTCAAGATTCCATGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067433665 10:46263017-46263039 GTGCCTGAGCCAGGATTCCAGGG + Intergenic
1067440016 10:46303291-46303313 GTGCCTGAGCCAGGATTCCAAGG - Intronic
1069745249 10:70710910-70710932 GCGCCCTACCAATGTTTCCAAGG - Intronic
1069814373 10:71184334-71184356 GTCCCCTAACCAAGATAGCAGGG + Intergenic
1071567216 10:86677571-86677593 GTGGCCTTCCTGAGATTCCATGG + Intronic
1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG + Intronic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1080838976 11:35966936-35966958 TTGCCCTACCAAGGATCCCAGGG - Intronic
1082803538 11:57431986-57432008 GTGCCCTACCCAGCCTTCCTGGG + Intergenic
1083619734 11:64042853-64042875 GTGCCACACCCCAGTTTCCAGGG + Intronic
1087662206 11:101000906-101000928 GTGCAATACCCAACATTCCTTGG - Intergenic
1090802265 11:130180286-130180308 GGTCCCTCCCCAGGATTCCAAGG + Intronic
1095512626 12:42969644-42969666 AGGCCCTAGCCATGATTCCATGG + Intergenic
1100299298 12:93292526-93292548 GTTCTCTACTCAAGCTTCCAAGG - Intergenic
1102236797 12:111298756-111298778 CTGCCCTCCCCAAGCTCCCAGGG + Intronic
1102577327 12:113864109-113864131 GTGACTTGCCCAAGGTTCCATGG + Intronic
1107614452 13:42150297-42150319 GTGCCCTAGACAGGGTTCCATGG + Intronic
1111999189 13:95194074-95194096 GTGCCCTCCTCATGCTTCCAAGG - Intronic
1113302732 13:109039581-109039603 GTGCCCTTCCAAATAATCCATGG + Intronic
1113926328 13:113943816-113943838 GAGCCCTACCAGACATTCCATGG + Intergenic
1114167712 14:20238641-20238663 GTGGCTTACCCAAGTTTCCCTGG - Intergenic
1114666921 14:24383306-24383328 GTGAGCTACCCAAGAAGCCAGGG + Intergenic
1118894035 14:69931082-69931104 CTTTCCTACCCAAGCTTCCACGG + Intronic
1119788706 14:77330689-77330711 GTGCCCTACCAAAGGGTTCACGG - Intronic
1121777893 14:96602845-96602867 GTCCCCTACCCAAGGGCCCATGG - Intergenic
1126639275 15:50808320-50808342 TTTTCCTACCCAAGATTCCAGGG + Intergenic
1127520683 15:59740354-59740376 CTGCCCTACCCTCGAGTCCAAGG - Intergenic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1131154332 15:90065463-90065485 GTGCCCTCTCCAGGCTTCCAAGG - Intronic
1132989247 16:2784701-2784723 GTGCCCTGCCCAACCGTCCAGGG - Exonic
1133112410 16:3556433-3556455 ATGCCCTACGCAAGTTTCCAGGG - Intronic
1133475656 16:6119065-6119087 ATGACCCACCCAAGATCCCATGG - Intronic
1134675849 16:16090124-16090146 GACCCCTGCCCCAGATTCCAGGG - Intronic
1140647551 16:77049576-77049598 CTTCCCTACCCAGGCTTCCATGG - Intergenic
1144106753 17:11992980-11993002 ATGCCCTACCCGAGAAGCCATGG + Intronic
1147807548 17:43142536-43142558 GTGACCTGCCCAAGTGTCCAAGG - Intergenic
1159077906 18:63702168-63702190 GTGCCCTATGCAAAATTCCAGGG - Intronic
1159093832 18:63879432-63879454 GCGACCTACCTAAGATTACATGG + Intronic
1160249311 18:77187105-77187127 GTGCTCCACCCAAGATGGCATGG - Intergenic
1164752491 19:30667051-30667073 TTGCCCTACCCAATTTTCCCAGG + Intronic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
925045651 2:771302-771324 CTGCCCTTCCCAGGACTCCAGGG + Intergenic
925449507 2:3956801-3956823 GTGCCCTCCTCAGGGTTCCACGG - Intergenic
925571482 2:5316935-5316957 GTGCCCTTCCCAAGCTCCCTGGG + Intergenic
925910529 2:8570800-8570822 GTGCCTGACCCAAGGTTCCCAGG - Intergenic
927229368 2:20805449-20805471 CTTCCCTACCTAAGAATCCAAGG + Intronic
927382753 2:22498115-22498137 GAGCCCTGCCCAAGACTTCATGG - Intergenic
929536311 2:42786614-42786636 GTGCCCTGTCCAAGATCCCGGGG + Intronic
929913572 2:46114709-46114731 GTGCCCAGCCCCAGAGTCCAAGG + Intronic
930917684 2:56713787-56713809 GTGCCTTACCCATGTTACCAAGG + Intergenic
932281006 2:70491782-70491804 CTGCCCTGTGCAAGATTCCATGG + Intronic
934043351 2:88148027-88148049 GTGCCCTGCCCAGGGGTCCAAGG + Intergenic
934579982 2:95430055-95430077 GTGACCTTCCCCAGATCCCAAGG - Intergenic
934599465 2:95646670-95646692 GTGACCTTCCCCAGATCCCAAGG + Intergenic
938164019 2:129010424-129010446 GTGCCCTGGCCAGGCTTCCACGG - Intergenic
948310774 2:236984640-236984662 CTGCCCTAACCAACTTTCCATGG - Intergenic
1170402778 20:16005780-16005802 CTGCCTTTCCCAACATTCCAAGG + Intronic
1170509445 20:17061361-17061383 GTGCCTTGGCCAAGATCCCAAGG + Intergenic
1170576080 20:17662527-17662549 CTGCCTTACCCAGGATTCAAAGG - Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1179005691 21:37512156-37512178 CTCCTCTACCCAAGATTCTATGG + Exonic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1181754728 22:25015737-25015759 GTGTCCTACCCTACATCCCATGG + Intronic
954155663 3:48683689-48683711 CTGCCATCCCCAACATTCCAGGG + Intronic
954367455 3:50154246-50154268 CTGCCCAACCCAACTTTCCAAGG - Intergenic
954843083 3:53530439-53530461 GTGCCATCCTCTAGATTCCAGGG - Intronic
955132460 3:56184590-56184612 GTAACATACCCAAGATTGCAAGG + Intronic
956493397 3:69798366-69798388 GTGACCAAACCAAGACTCCAAGG - Intronic
958906696 3:99949566-99949588 GTGCCCTGAGAAAGATTCCAAGG - Intronic
958950805 3:100413666-100413688 GTGCCCTACACAAGAATGCTGGG + Intronic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
961984931 3:131122235-131122257 GTGTCCTACCCCAGATTTGAAGG + Intronic
962577784 3:136770594-136770616 AAGTCCTACCCAAGATGCCATGG + Intergenic
963968768 3:151405379-151405401 GTTCCCTGCTCAAGCTTCCATGG - Intronic
966433507 3:179857680-179857702 TTTACTTACCCAAGATTCCATGG + Intronic
969417348 4:7069159-7069181 GTGCCCTCCCCGGGATCCCAGGG + Intergenic
969417361 4:7069191-7069213 ATGCCCTCCCCAGGATCCCAGGG + Intergenic
971159099 4:24114857-24114879 ATGGCCTACACAAGATTCTAAGG - Intergenic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
981938986 4:150261563-150261585 TTGCCAAAACCAAGATTCCAGGG - Intergenic
983873541 4:172850194-172850216 TTGTCCTACACAAGATGCCAAGG - Intronic
983881375 4:172937001-172937023 GTGCCCTACCAGAGATGCCCAGG - Intronic
987795733 5:22625414-22625436 GTGCACAACCCACGATCCCATGG + Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
1000163702 5:158626528-158626550 GTGCCCTGCACAAGAATCCCTGG - Intergenic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1001590026 5:172858799-172858821 GGGCCCTGCCCAAGATTCCAAGG + Intronic
1005398783 6:25410460-25410482 GTTACCTGCCCAAGATTGCATGG + Intronic
1008547260 6:52594249-52594271 GTGCCCAACCCAAGACTTGAAGG + Intergenic
1010678993 6:78777175-78777197 GTACCCTACCGAAAATGCCATGG + Intergenic
1010895192 6:81353433-81353455 GTGTCCTAGCCCAGCTTCCAGGG + Intergenic
1011067293 6:83341056-83341078 ATGCCCTACCCCAGATCACATGG - Intronic
1016159670 6:140863172-140863194 GTGCCTTACCAATGATTCGAAGG + Intergenic
1020059916 7:5144273-5144295 GTGCCCTGCGCGAGCTTCCAGGG + Intergenic
1029993141 7:104980354-104980376 AGGCCCAACCAAAGATTCCAGGG + Intergenic
1030014491 7:105205010-105205032 CTGACCTTCTCAAGATTCCAGGG - Intronic
1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG + Intergenic
1035246548 7:157566214-157566236 ATGCCCTTCCCAAGCTTCCCGGG - Intronic
1037855907 8:22370469-22370491 GTCCCCTGCTCAACATTCCATGG - Intronic
1039455627 8:37704021-37704043 CTGCCCTACCCTGGACTCCAGGG - Intergenic
1042700089 8:71602689-71602711 CTGCCCTTCCCTAAATTCCAGGG - Intergenic
1049918239 9:338948-338970 GTCCCCAACCCAAGAGTCAAAGG + Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1056618589 9:88190987-88191009 GTGCTCTGCTCAAGATCCCATGG + Intergenic
1058976471 9:110129441-110129463 GTGCCCTAGCCAGGATTTGAAGG - Intronic
1060587063 9:124793201-124793223 CTGCCCTTCCCAAGAAGCCAGGG + Intronic
1062021061 9:134319628-134319650 GCCTCCTACCCAAGACTCCAGGG - Intronic
1188568482 X:31553364-31553386 GGGCCCTACCCAAGACTGCATGG - Intronic
1188895208 X:35659101-35659123 CTGCCCTACAGAAGATCCCAAGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189566193 X:42243616-42243638 GTGCTTTAACCAAGCTTCCAGGG + Intergenic
1196981815 X:121222702-121222724 TTGCCCTATCCTAGATGCCAGGG + Intergenic
1197510228 X:127361776-127361798 GTGCAAGACCCAAGCTTCCATGG - Intergenic
1199684357 X:150253527-150253549 CTGCTCTACCCAATATTCCTGGG - Intergenic
1200153009 X:153960406-153960428 CTGCCCTCCCCCAGATACCATGG - Exonic