ID: 1078854867

View in Genome Browser
Species Human (GRCh38)
Location 11:15198990-15199012
Sequence CTAACATGCTCGGAGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078854867 Original CRISPR CTAACATGCTCGGAGGGTGG GGG (reversed) Intronic
902216319 1:14936560-14936582 CTTAACTGCTGGGAGGGTGGAGG - Intronic
903861177 1:26365318-26365340 CTAGCAGGCTCGCAGGCTGGAGG - Intronic
904789756 1:33010575-33010597 ACACCATGCTTGGAGGGTGGGGG - Intronic
906258269 1:44367198-44367220 CTTACAAGCAGGGAGGGTGGAGG + Intergenic
906655853 1:47548036-47548058 TTAACATGCGGGGTGGGTGGGGG - Intergenic
907380470 1:54083108-54083130 CTAAAATGGTGGGTGGGTGGTGG + Intronic
907890278 1:58630587-58630609 ACACCATGCTTGGAGGGTGGGGG - Intergenic
912648663 1:111418959-111418981 CTTACATGAAGGGAGGGTGGTGG + Intronic
915882089 1:159683021-159683043 GTATCATGGTCGGGGGGTGGGGG - Intergenic
919483061 1:198112853-198112875 CTAAAAGGCTCAGGGGGTGGGGG + Intergenic
1064832711 10:19489030-19489052 CTCAGCAGCTCGGAGGGTGGAGG + Intronic
1066679374 10:37922175-37922197 CTAACATGCTGGCAAGGTTGTGG + Intergenic
1074886575 10:117698775-117698797 CTCACATGCTCAGAGGGTTGAGG - Intergenic
1076241100 10:128908374-128908396 CTAACGTGCTCAGAAGATGGAGG - Intergenic
1078491117 11:11769812-11769834 CTTCCATGCTGGGATGGTGGTGG - Intergenic
1078493761 11:11795573-11795595 CTGACATTTTGGGAGGGTGGAGG - Intergenic
1078854867 11:15198990-15199012 CTAACATGCTCGGAGGGTGGGGG - Intronic
1079334063 11:19555694-19555716 CTAGCATTCTCTGAGGGTGTGGG + Intronic
1080962116 11:37172824-37172846 TTAGCATGATCTGAGGGTGGAGG + Intergenic
1085733611 11:79019990-79020012 CTAACAGGCTGGCAGGGTGGTGG - Intronic
1089948381 11:122501751-122501773 TTAACATGCTCGCAGGCTGGAGG - Intergenic
1090517281 11:127442383-127442405 CTCACATGATGGAAGGGTGGAGG - Intergenic
1099229770 12:80009797-80009819 GTAAGATGCTGGGAGGGAGGTGG - Intergenic
1102362852 12:112303303-112303325 CTAACATGCTCTAAGGCTGGTGG + Intronic
1103644909 12:122383957-122383979 CTTACATGTTGGGAGGGTGGGGG - Intronic
1104403601 12:128498042-128498064 CAAACATGCTAGGGGGATGGAGG - Intronic
1110869373 13:80432391-80432413 CCAACATTCTTGGTGGGTGGGGG + Intergenic
1111413915 13:87913567-87913589 CTCAGTTGCTGGGAGGGTGGAGG + Intergenic
1111750391 13:92323091-92323113 TTAACATGCTCTGAGGGAAGTGG + Intronic
1122861152 14:104582902-104582924 CTGGCATGCTCGGCAGGTGGGGG - Intronic
1126982115 15:54255822-54255844 ATAACATGCTGGGAGAGAGGTGG - Intronic
1127389232 15:58491899-58491921 CTAACAGGCCTGGAGGCTGGAGG + Intronic
1143314971 17:6025682-6025704 TTAGCATGATCTGAGGGTGGAGG + Intronic
1147720258 17:42535632-42535654 CTAACAGGCTAGGAGGTTCGAGG - Intergenic
1148678137 17:49456969-49456991 CTTACATGCTTACAGGGTGGAGG - Intronic
1149596541 17:57867765-57867787 CCAACATGCTTGGAGTGAGGAGG + Intronic
1151998930 17:77632585-77632607 CTCACATGGTAGAAGGGTGGGGG - Intergenic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1152328606 17:79657306-79657328 ATAACATGCTGGGAGTGTGTGGG - Intergenic
1152991238 18:365795-365817 CCAACATGGTCAGAGGGTGCGGG - Intronic
1159581010 18:70234787-70234809 CTCACATGCTCTGAGAGAGGCGG + Intergenic
1159773884 18:72582315-72582337 CTGACATGATCTGAGTGTGGTGG + Intronic
1162948093 19:14055470-14055492 CTAGCATGCAGGGAGGCTGGAGG - Intronic
926996382 2:18740536-18740558 TCATCATGCTGGGAGGGTGGTGG + Intergenic
933985004 2:87583703-87583725 CAATCATGCTCACAGGGTGGTGG - Intergenic
936308842 2:111367108-111367130 CAATCATGCTCACAGGGTGGTGG + Intergenic
936683796 2:114804396-114804418 CTACCATTCTGGGAGGATGGTGG - Intronic
941653524 2:168119071-168119093 CTCACATGCTCACAGGGAGGAGG - Intronic
942142692 2:172993771-172993793 CTAACATTCCCTTAGGGTGGGGG - Intronic
942962512 2:181849003-181849025 TTAAGATGCTTGCAGGGTGGAGG + Intergenic
949069743 2:242017298-242017320 CTACCAGGCTCTGGGGGTGGCGG - Intergenic
1172395922 20:34605089-34605111 CTAACATGCTCAGGGGCAGGAGG - Intronic
1175154129 20:56958049-56958071 CTAACATGGTGGGGGAGTGGGGG + Intergenic
1177323697 21:19556177-19556199 ATCAAATGCTTGGAGGGTGGAGG - Intergenic
1178320375 21:31600633-31600655 CTAACATGCACGGAGGGAAGAGG + Intergenic
952315618 3:32229732-32229754 CTGACACATTCGGAGGGTGGAGG - Intergenic
956856015 3:73275538-73275560 CTTACATGGTGGCAGGGTGGTGG + Intergenic
961360317 3:126363176-126363198 CTCACATGGTGGGAGGGAGGAGG - Intergenic
965824138 3:172713810-172713832 TTTATATGCTTGGAGGGTGGTGG + Intergenic
967799163 3:193635636-193635658 CTAATGTGCTTGGAGGATGGAGG + Intronic
969060345 4:4429052-4429074 CTGCCATGGTTGGAGGGTGGGGG - Intronic
970806291 4:20038069-20038091 CTCACATGCTGGGAGGGTGAGGG - Intergenic
974598772 4:64048331-64048353 CTCACATGGTCAAAGGGTGGTGG - Intergenic
976375206 4:84338549-84338571 CACACATGCTGGTAGGGTGGCGG + Intergenic
982173143 4:152680729-152680751 AGAATATGCTCTGAGGGTGGAGG + Intergenic
982188782 4:152831933-152831955 CTGAAATACTCGGGGGGTGGGGG - Intronic
986000762 5:3628939-3628961 CTCACATTCCCGGAGGCTGGGGG - Intergenic
986254572 5:6091533-6091555 CTAACATGCTGGGTGGGTGAAGG - Intergenic
986448760 5:7846488-7846510 CTCACATGCTGGGAGGGGCGAGG + Intronic
1001877121 5:175211068-175211090 CGACCATGCTGGGTGGGTGGAGG - Intergenic
1007761800 6:44137661-44137683 TTTACATGCCTGGAGGGTGGAGG + Intronic
1018672670 6:166192702-166192724 CCAACATGGGCAGAGGGTGGTGG + Intergenic
1018815166 6:167325093-167325115 CTGAAATGCGCGGAGGCTGGAGG - Exonic
1020212687 7:6167777-6167799 CCACCATGCTGGGAGCGTGGAGG - Intronic
1023769215 7:43539751-43539773 CTAACATGATAGTAGGGTTGTGG - Intronic
1030757390 7:113303959-113303981 ATAACATGCTGGGAAGGTTGTGG - Intergenic
1032333075 7:130998510-130998532 ATAACATACTCTGGGGGTGGGGG - Intergenic
1036239050 8:7067386-7067408 CTAACATGCAGGGAGGGATGGGG - Intergenic
1036817755 8:11914564-11914586 CTAACATGCAAGGAGGGAAGGGG + Intergenic
1036906763 8:12713819-12713841 CTAACATGCAGGGAGGGAAGGGG + Intergenic
1041765222 8:61411930-61411952 ATAACATACTGTGAGGGTGGAGG + Intronic
1046077654 8:109332520-109332542 CTCATATGTTTGGAGGGTGGGGG - Intronic
1048845433 8:138600461-138600483 CTGACATGCTCAGAGTGGGGAGG + Intronic
1049626806 8:143627137-143627159 ATCAAATGCTCAGAGGGTGGAGG - Intergenic
1051233386 9:14975377-14975399 CTGACATGCTCGCAGGGATGAGG + Intergenic
1061561513 9:131407219-131407241 TTGACATGGTTGGAGGGTGGGGG + Intronic
1061681639 9:132245338-132245360 CTGACCTCCCCGGAGGGTGGAGG + Intergenic
1062658555 9:137616428-137616450 CTGTCATGCTATGAGGGTGGGGG - Intronic
1188008964 X:25038410-25038432 CTAACATGCATGGAAGCTGGAGG + Intergenic
1194894815 X:99427335-99427357 GTAACAATCTTGGAGGGTGGGGG - Intergenic
1197326200 X:125097107-125097129 CTAACATGAGGGTAGGGTGGTGG - Intergenic
1201681523 Y:16649516-16649538 TTAACAAGCTCTGGGGGTGGTGG + Intergenic