ID: 1078857351

View in Genome Browser
Species Human (GRCh38)
Location 11:15217086-15217108
Sequence CTTTATAAATTACCCAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16749
Summary {0: 3429, 1: 4465, 2: 3325, 3: 3035, 4: 2495}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078857351_1078857361 27 Left 1078857351 11:15217086-15217108 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1078857361 11:15217136-15217158 CACAGGACTGGGGAGGTCTCAGG 0: 1
1: 27
2: 308
3: 1533
4: 3036
1078857351_1078857354 -6 Left 1078857351 11:15217086-15217108 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1078857354 11:15217103-15217125 ATAAAGGAAAGAGGTTTAATTGG 0: 194
1: 2224
2: 4314
3: 4000
4: 3705
1078857351_1078857359 20 Left 1078857351 11:15217086-15217108 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1078857359 11:15217129-15217151 ACAGTTCCACAGGACTGGGGAGG 0: 14
1: 402
2: 4848
3: 7375
4: 8030
1078857351_1078857357 16 Left 1078857351 11:15217086-15217108 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1078857357 11:15217125-15217147 GCTCACAGTTCCACAGGACTGGG 0: 2
1: 31
2: 574
3: 4569
4: 8117
1078857351_1078857355 10 Left 1078857351 11:15217086-15217108 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1078857355 11:15217119-15217141 TAATTGGCTCACAGTTCCACAGG 0: 231
1: 977
2: 2316
3: 3783
4: 4792
1078857351_1078857356 15 Left 1078857351 11:15217086-15217108 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1078857356 11:15217124-15217146 GGCTCACAGTTCCACAGGACTGG 0: 2
1: 27
2: 519
3: 4134
4: 7915
1078857351_1078857358 17 Left 1078857351 11:15217086-15217108 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1078857358 11:15217126-15217148 CTCACAGTTCCACAGGACTGGGG 0: 16
1: 393
2: 3966
3: 7413
4: 9298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078857351 Original CRISPR CTTTATAAATTACCCAGTCT TGG (reversed) Intronic
Too many off-targets to display for this crispr