ID: 1078857356

View in Genome Browser
Species Human (GRCh38)
Location 11:15217124-15217146
Sequence GGCTCACAGTTCCACAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12597
Summary {0: 2, 1: 27, 2: 519, 3: 4134, 4: 7915}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078857351_1078857356 15 Left 1078857351 11:15217086-15217108 CCAAGACTGGGTAATTTATAAAG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495
Right 1078857356 11:15217124-15217146 GGCTCACAGTTCCACAGGACTGG 0: 2
1: 27
2: 519
3: 4134
4: 7915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078857356 Original CRISPR GGCTCACAGTTCCACAGGAC TGG Intronic
Too many off-targets to display for this crispr