ID: 1078860386

View in Genome Browser
Species Human (GRCh38)
Location 11:15241082-15241104
Sequence CCTAGCAAAAAGAAGTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078860386 Original CRISPR CCTAGCAAAAAGAAGTTGGG TGG (reversed) Intronic
900426520 1:2582663-2582685 CCAAGCAAAACGGAGCTGGGAGG - Intergenic
901013711 1:6215640-6215662 ACAAGCAAAAAGCAATTGGGAGG - Intronic
904228211 1:29042765-29042787 CCAAAAAAAAAAAAGTTGGGGGG - Intronic
906753338 1:48285900-48285922 CCTCAAAAAAAGATGTTGGGGGG - Intergenic
908588027 1:65595320-65595342 CCTAACACAATGGAGTTGGGAGG - Intronic
909254491 1:73401923-73401945 TCTAGCAGAAAGATGGTGGGAGG - Intergenic
910119614 1:83772040-83772062 CCAAACAAAATGAAGATGGGAGG + Intergenic
912206718 1:107517015-107517037 AGTAGCAGAAAGGAGTTGGGAGG - Intergenic
913962052 1:143347600-143347622 CGAAACAAAAAGAAGTTAGGAGG - Intergenic
914056408 1:144173175-144173197 CGAAACAAAAAGAAGTTAGGAGG - Intergenic
914122738 1:144793187-144793209 CGAAACAAAAAGAAGTTAGGAGG + Intergenic
915351055 1:155226450-155226472 CCTTGGAAAAGGAAATTGGGAGG + Intergenic
915992333 1:160530190-160530212 CCTAGCCAAGGGAAGCTGGGAGG - Intergenic
916316907 1:163459196-163459218 GCTAGCAAAAATGTGTTGGGAGG + Intergenic
917157883 1:172024716-172024738 CCTAGCAAAGAGAAGCTGGGAGG + Intronic
918167300 1:181962126-181962148 CCTAGCCAAAAGAAGCTGTGAGG - Intergenic
918233735 1:182558857-182558879 CATAGCAAAAGGAATTTGGTGGG - Intronic
919190098 1:194205272-194205294 CCTAGAAAAAAGAGATTGAGAGG + Intergenic
919981596 1:202645369-202645391 CCTAGCAAAAGAAGGTTTGGGGG - Intronic
920976927 1:210795102-210795124 ACAAGCAAAAAGAAATTGGGTGG - Intronic
921042409 1:211446509-211446531 AGTTGCAAAAAGAAGTTAGGTGG + Intergenic
921250314 1:213291253-213291275 CCTCACACAAAGAAGTTGGAAGG - Intergenic
922236023 1:223723373-223723395 ACTAGCAAATAGATGTTGGCTGG + Intronic
922396734 1:225209914-225209936 CCTAGCCAAGAGAAGTTGTGAGG + Intronic
922575476 1:226658414-226658436 CCTGCCAAAAAGGAGCTGGGAGG + Intronic
923491887 1:234491463-234491485 CCTAGCAAAAGGAATTGGGTGGG - Intergenic
1063202489 10:3797304-3797326 TCTAGAAAACAGAAGGTGGGTGG - Intergenic
1063764232 10:9119536-9119558 CGTAGGAAACAGAAGTTGGGAGG + Intergenic
1063950213 10:11215023-11215045 CTTAGTGAAAAGAAGGTGGGTGG - Intronic
1067188268 10:44048574-44048596 CCTAGCAACAAGAAGAAAGGAGG + Intergenic
1068608128 10:59028475-59028497 CATAGCAACAGGAAGTTGGGTGG + Intergenic
1071701607 10:87944835-87944857 TCAAGCAGAAAGAAGATGGGAGG + Intronic
1072832487 10:98673738-98673760 CCTATTAAAAAGAAGTAGTGAGG + Intronic
1073499684 10:103925146-103925168 AATAGCACAAAGAAGGTGGGAGG - Intergenic
1078078015 11:8179028-8179050 GCTAGCAAAAATAAGGGGGGTGG + Intergenic
1078860386 11:15241082-15241104 CCTAGCAAAAAGAAGTTGGGTGG - Intronic
1078976219 11:16480650-16480672 CATAATAAAAAGAAGGTGGGGGG - Intronic
1080134228 11:28835492-28835514 CTTAGCAAAAAGAATCTGGGTGG + Intergenic
1080747018 11:35117033-35117055 CCTAGGAAAAGGGCGTTGGGTGG + Intergenic
1081208892 11:40307469-40307491 CCTAGGAAAAAGAATTTTAGAGG - Intronic
1083888101 11:65582423-65582445 CCCAGGAGAAAGAAGTTGAGGGG + Exonic
1086611821 11:88766433-88766455 CCTAGCAAAAAGAAGCAATGGGG + Intronic
1087335351 11:96837330-96837352 TCTATCAAAAAGAATGTGGGTGG + Intergenic
1089348094 11:117804535-117804557 CCTGGCAAAAGGAAGGTGTGGGG - Intronic
1090348150 11:126087575-126087597 GAAAGCAAAAAGAAGTTGGAGGG + Intergenic
1092567759 12:9686074-9686096 CCTAGCCAAGGGAAGTTGTGAGG - Intronic
1093871730 12:24300615-24300637 CCTGGAAGAAAGAAGTTGTGGGG - Intergenic
1101058787 12:100948999-100949021 CCTAGCAAAGAAAGGTGGGGTGG + Intronic
1101296020 12:103424588-103424610 CCTAGCCAAAGGAAGTTGTGAGG + Intronic
1102481491 12:113226955-113226977 CCTAGCAAAAGTAAGATGGTGGG + Exonic
1104347423 12:128013825-128013847 CCTAGCAAAGTGAGGGTGGGAGG + Intergenic
1106691217 13:32119243-32119265 ACTAGGAAAAAAAGGTTGGGGGG + Intronic
1107041069 13:35948060-35948082 CATGGCAAGAAGAAGTTGGGTGG - Intronic
1107202367 13:37737027-37737049 AATATCAAAAAGAAGTTGGCTGG - Intronic
1107640242 13:42434922-42434944 GCTAGGAAAAACAAGTTGGAAGG + Intergenic
1109257299 13:60098478-60098500 CCTGGTAAAAAGGAGCTGGGAGG + Intronic
1110746524 13:79060179-79060201 GCTAGCAAAAAGGGATTGGGAGG - Intergenic
1111558690 13:89914458-89914480 ACAAGCAGAAAGAAGTTGGAAGG - Intergenic
1111749500 13:92310731-92310753 CCTAGAAAAAGGCAGTAGGGAGG - Intronic
1112704056 13:102046151-102046173 CTTAGGAAAAAGGAGTTAGGGGG - Intronic
1112812184 13:103231646-103231668 TCTAACAAAATGGAGTTGGGAGG + Intergenic
1113149557 13:107247514-107247536 CTTAGCAAAAAGATGTTTAGTGG + Intronic
1117599931 14:57364821-57364843 CCTAGCCAAGAGAAGCTGTGAGG + Intergenic
1118354213 14:64998726-64998748 ACTTGTTAAAAGAAGTTGGGTGG + Intronic
1119537198 14:75412219-75412241 CGTACCAAAAAGAAGTGGCGTGG + Intergenic
1119586759 14:75842960-75842982 CATAGCAAAAAGAAGAAAGGTGG + Intronic
1119971290 14:78973277-78973299 CATAGAAAAAAGAACTTGGAAGG + Intronic
1123211445 14:106764770-106764792 CCTAGGAAACAGAATTTAGGAGG - Intergenic
1128884747 15:71276319-71276341 GCTGGCAAAAAGAAGATGCGGGG - Intronic
1130628569 15:85541549-85541571 CCTAGCAAAAAGAAACAGGGTGG + Intronic
1132417824 15:101636590-101636612 CCTAGCAAAATGAATCCGGGAGG - Intronic
1136645940 16:31615013-31615035 TCTAAAAAAAAGAAGGTGGGGGG - Intergenic
1137437494 16:48468562-48468584 ACTAGCACAAAGGAGTGGGGAGG - Intergenic
1137497766 16:48983906-48983928 CCTCACAAAGAGAATTTGGGGGG + Intergenic
1138827600 16:60339305-60339327 CATAGCAAAAACATGTTTGGTGG - Intergenic
1138936560 16:61732865-61732887 CATAGCAAAAAGGAGGTGAGTGG + Intronic
1139080804 16:63518065-63518087 AATAGCATAAAGAAGATGGGTGG - Intergenic
1143890092 17:10096365-10096387 CCTGGCAAACAGAAGAGGGGAGG - Intronic
1144227586 17:13165235-13165257 CCTAGCAAACTGAAGTTATGAGG - Intergenic
1145747648 17:27332255-27332277 ATTAGCAAAAAGAATTTTGGAGG + Intergenic
1146736654 17:35243921-35243943 CCTAACAAAAAGAAGTAGTGGGG + Intronic
1148867382 17:50635501-50635523 CCTAGAGAAAAGAAGGTGGCAGG - Intronic
1149426265 17:56557680-56557702 CCTACCAAAATGACGCTGGGTGG + Intergenic
1151261220 17:72917384-72917406 CCTACCTAAATGGAGTTGGGAGG + Intronic
1151565437 17:74894724-74894746 CCTAGGAAAGAGAAGTTGGGTGG + Intergenic
1153091426 18:1349621-1349643 CCTAGGATACAGAAGATGGGAGG + Intergenic
1153355072 18:4125303-4125325 CCTAGCAGTAGGAAGTGGGGGGG + Intronic
1153477469 18:5512660-5512682 CCCAGCAGAAAGAAGATGAGGGG + Intronic
1153525486 18:5991092-5991114 CCAAGCAAAGAGAAGAGGGGTGG - Intronic
1155856021 18:30835607-30835629 CAAAACAAAAAGAAGTAGGGTGG + Intergenic
1157908583 18:51593537-51593559 CATAGCAAAAAAAAATTAGGGGG - Intergenic
1160331130 18:77992550-77992572 CCTAGCAATAAGAATATTGGTGG - Intergenic
1161256666 19:3313688-3313710 CCAAGCAGAGACAAGTTGGGGGG - Intergenic
1161759669 19:6161742-6161764 CCTAGCAAAAGGACGTAGGCGGG + Intronic
1161785622 19:6323696-6323718 CCTACCAAAAGCAAGATGGGAGG - Intronic
1164283496 19:23789975-23789997 CATACAAAAAAGAAGCTGGGGGG - Intronic
1166107384 19:40604053-40604075 CCAGCCAGAAAGAAGTTGGGCGG + Intronic
1166715443 19:44964142-44964164 TATCGCAAAAAAAAGTTGGGGGG + Intronic
1168317836 19:55491711-55491733 CCCAGCAAACAGCGGTTGGGGGG + Intronic
1202695888 1_KI270712v1_random:125852-125874 CGAAACAAAAAGAAGTTAGGAGG - Intergenic
924967298 2:90776-90798 CCTAGCCAAGAGAAGCTGTGAGG + Intergenic
925252512 2:2451919-2451941 CCTAGCCAAGAGAAGCTGTGAGG - Intergenic
926462831 2:13154386-13154408 CTTAGCAAAAAGTAGTTGGATGG - Intergenic
927124584 2:20002349-20002371 CCTAGAAAAAAGTTTTTGGGAGG - Intronic
929755331 2:44759414-44759436 CTGAGCAAAAAGAACTTGGCTGG - Intronic
930476721 2:51891599-51891621 CCTAGCCAAAGGAAGTCGTGAGG - Intergenic
932216094 2:69966853-69966875 CCTAACATACAGAAGATGGGGGG + Intergenic
932622244 2:73271629-73271651 CTCAAAAAAAAGAAGTTGGGGGG - Intronic
933082710 2:78013355-78013377 CATGACAAAAAGAAGTTAGGAGG + Intergenic
935683678 2:105663902-105663924 CCAAGCAAAAAGAAGCTATGTGG - Intergenic
935914659 2:107936051-107936073 CCAAAAAAAAAAAAGTTGGGGGG + Intergenic
936371228 2:111903920-111903942 CCTAGACAAAAGGTGTTGGGAGG + Intronic
936409253 2:112240079-112240101 CCTAGAGACAAGAAGTTTGGTGG - Intronic
939298184 2:140297164-140297186 CATAGGAGAAAGAAGCTGGGGGG + Intronic
943350653 2:186792928-186792950 CCTAGCCAAAGGAAGCTGTGAGG + Intergenic
944827728 2:203502563-203502585 CCTTAGAAAAAGAATTTGGGAGG + Intronic
945990093 2:216388783-216388805 CCTAGCAAAGTGAAAGTGGGAGG - Intergenic
947245464 2:228042706-228042728 CCAAGTAAATAGAAATTGGGTGG - Intronic
947965014 2:234272829-234272851 CCTAATAAAATGGAGTTGGGAGG + Intergenic
1170759490 20:19237212-19237234 CCATGGAAAGAGAAGTTGGGAGG + Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171789110 20:29502209-29502231 GATAGCAAAAAGAAGAAGGGAGG + Intergenic
1172642508 20:36449247-36449269 CCTAGCAGAAAGAAGCTGAGTGG - Intronic
1175828862 20:61951178-61951200 CCCAGGAAAAGGAAGGTGGGGGG - Intergenic
1178186550 21:30228493-30228515 CCTATTAAAAATAAGTAGGGTGG + Intergenic
1178267618 21:31158678-31158700 CCTTCCAAAAAAAATTTGGGGGG - Intronic
1181053931 22:20250777-20250799 CCTAACACAAATAAGTTGGGAGG + Intronic
949368947 3:3313787-3313809 CTTAGCAAATAGAAATTGGTTGG - Intergenic
950985199 3:17356359-17356381 CCCAGTAGAAAGAACTTGGGGGG - Intronic
951729463 3:25794889-25794911 CCTAGCAAAAAGGAGTTGAAAGG - Intergenic
952185844 3:30967870-30967892 CCAAGAAAGAAGAAGATGGGAGG + Intergenic
952195908 3:31075152-31075174 CCTAGTAAAGAGATGGTGGGGGG + Intergenic
959453710 3:106533978-106534000 CCTAGCCAAGGGAAGTTGTGAGG + Intergenic
960636476 3:119789684-119789706 CCGAGGAAACAGAAGTTGTGAGG - Intronic
961210604 3:125122463-125122485 ATAAGCAAAGAGAAGTTGGGAGG + Intronic
962765646 3:138560276-138560298 ACTAGCCAAGAGAAGCTGGGAGG + Intronic
963792918 3:149602666-149602688 CGTCTCAAAAAAAAGTTGGGGGG - Intronic
963876750 3:150484130-150484152 TCTAAAAAAAAAAAGTTGGGGGG + Intergenic
964065276 3:152570383-152570405 CCTCTAAAAAAGAAGATGGGGGG - Intergenic
964104867 3:153028191-153028213 CTCAGAAAAAAAAAGTTGGGGGG + Intergenic
966964987 3:184982110-184982132 CATAGCTAAAGGAAATTGGGTGG + Intronic
967471667 3:189869093-189869115 CCTAGCAATAAGGAGGTGGAAGG - Intronic
967488015 3:190056818-190056840 CCTAGGCAAAGGAAGTGGGGAGG - Intronic
968085340 3:195871603-195871625 CTTAGGAAAATGAACTTGGGAGG - Intronic
971016370 4:22493440-22493462 TCTAACAAAAAGAGGTTGGATGG - Intronic
971226536 4:24758682-24758704 CCTGGCAAAAAGAAAAAGGGTGG - Intergenic
971943259 4:33241799-33241821 CCTGGCCAAAAGAAGCTGTGAGG - Intergenic
976024008 4:80664954-80664976 CCTAGCCAAAGGAAGCTGCGAGG - Intronic
976744890 4:88392597-88392619 CCTAATAAAATGGAGTTGGGTGG + Intronic
977059411 4:92238548-92238570 CCTGCCAAAAAGAAGTGGGCAGG - Intergenic
977659959 4:99573472-99573494 CCTAGCAAAAATAAATTGTTTGG - Intronic
979959343 4:126998610-126998632 CCTAGACAGAAGAACTTGGGAGG + Intergenic
980461961 4:133126056-133126078 CCTAGTAAACAGAAGAGGGGAGG + Intergenic
980629315 4:135412494-135412516 CCCAGCAAAAGCAAGGTGGGAGG + Intergenic
981206239 4:142043864-142043886 CCTAGCATGAATAAGTAGGGTGG + Intronic
982265745 4:153536913-153536935 CATAGGAAAAAGATGTTGGCTGG + Intronic
987166453 5:15203220-15203242 CCTATAAACAAGAATTTGGGTGG + Intergenic
987274746 5:16350529-16350551 CCTAACAAAAGGGAGCTGGGAGG - Intergenic
987308028 5:16656556-16656578 TATAGCAAAAAGAAACTGGGTGG + Intergenic
987576030 5:19730019-19730041 CAAAGCAGAAAGAAGGTGGGAGG - Intronic
988037698 5:25849966-25849988 CCTGGCAAAATGGAGTTAGGTGG + Intergenic
988618147 5:32794922-32794944 CCTAGCCAAAGGAAGCTGTGAGG + Intergenic
990127651 5:52538099-52538121 CCTAACAAAAAGAAGATATGGGG + Intergenic
999196791 5:149786970-149786992 CCCCGCAAAAAGAAGTTGATTGG + Intronic
1006543850 6:34763207-34763229 CCTAACAAAAAGAGCATGGGAGG - Intronic
1006861278 6:37172929-37172951 ACAAGCACAAAGAAGCTGGGTGG - Intronic
1007622229 6:43222294-43222316 CCTAGCAAGGATACGTTGGGAGG - Exonic
1007906412 6:45465941-45465963 CATAGAAAAAAGAAGTAGGGCGG - Intronic
1008801576 6:55374887-55374909 CCTAGCAAAAACAAGCAGTGGGG - Intronic
1011806440 6:91078192-91078214 ACTAGCAGAAAGAAGTGTGGAGG - Intergenic
1012243394 6:96898916-96898938 CTTAGCAAAATGAAGTAGAGTGG + Intergenic
1013990673 6:116251453-116251475 CCTTGCTAAAAGAAGTGGGGTGG + Exonic
1014489989 6:122050833-122050855 CCCAGGAAAAAGAGGTAGGGAGG + Intergenic
1014759221 6:125337306-125337328 CCTTGCAAAATGACCTTGGGGGG + Intergenic
1015153593 6:130065259-130065281 CATAGTAAAAAGAAGTCCGGAGG - Intronic
1016301532 6:142637034-142637056 CCCAGCCCAAGGAAGTTGGGTGG + Intergenic
1016466803 6:144333923-144333945 CCTAGCACATAGTAGGTGGGTGG - Intronic
1020874338 7:13674245-13674267 CCTAGCCAAAGGAAGCTGTGAGG - Intergenic
1021489763 7:21206845-21206867 ACTGGTAAAAAGAAGCTGGGTGG - Intergenic
1022638851 7:32162524-32162546 CCCAGTAAAAGAAAGTTGGGTGG + Intronic
1023455318 7:40332608-40332630 CCTAGTTCAAAGAAGCTGGGAGG + Intronic
1028606637 7:92662820-92662842 GATTGCAAAGAGAAGTTGGGAGG + Intronic
1031461856 7:122061058-122061080 CCTAGAGAACAGAAGATGGGAGG - Exonic
1031696340 7:124860201-124860223 CATAGCAAAAATATATTGGGAGG - Intronic
1035425729 7:158771498-158771520 CCTTGCACACACAAGTTGGGCGG + Intronic
1038812154 8:30859004-30859026 CCTATCAAAAAAAAATTGTGGGG - Intronic
1040440396 8:47435791-47435813 CTTAGCATAATGAAGTAGGGGGG + Intronic
1041085301 8:54251215-54251237 CATAGCAAAAAGCAGAAGGGTGG - Intergenic
1041423503 8:57695074-57695096 CCTAGCCAAGGGAAGTTGTGAGG + Intergenic
1043445018 8:80310920-80310942 CCTAAAAAAAAAAGGTTGGGAGG - Intergenic
1043730968 8:83681113-83681135 CCTAGCACATAGAAATTGTGTGG + Intergenic
1046630560 8:116619036-116619058 CCAAGCCAAAATAAGTGGGGTGG - Intergenic
1048257387 8:132915411-132915433 CCTGTCAACAAGAAGATGGGAGG + Intronic
1048842379 8:138577285-138577307 CCTGGCAAAGAGAAGAGGGGAGG - Intergenic
1050877635 9:10659532-10659554 CCTGTCAAAAAGAAGATGGATGG - Intergenic
1054719950 9:68594380-68594402 CCTAGCCAATAGAAGCTGTGAGG - Intergenic
1055283235 9:74698835-74698857 TGTAGCAAAAAGAATTTGAGAGG + Intergenic
1055981434 9:82006405-82006427 CCTTGCAACAAGATGATGGGAGG - Intergenic
1186803034 X:13112651-13112673 ACTGGCAAAAAAAAGTTGGTGGG + Intergenic
1187476580 X:19616404-19616426 ACTAGCAACAAGAAACTGGGTGG + Intronic
1189676372 X:43464761-43464783 TCTAGAAAAAATAAGTTAGGTGG - Intergenic
1189845100 X:45128668-45128690 CCTAGCAGGGAGAACTTGGGTGG + Intergenic
1189876283 X:45439957-45439979 CCTAGGAAAAAGATATTGTGAGG + Intergenic
1193377594 X:80779935-80779957 CCTAGCAAAAAGATGTTCAATGG - Intronic
1198505848 X:137300724-137300746 CCAAGCACCAAGAAGTTTGGTGG + Intergenic
1198769826 X:140118640-140118662 CATAGGAAAAAAAAGTTGGAGGG - Intergenic
1201342728 Y:12951832-12951854 TATAGAAAAAAAAAGTTGGGTGG - Intergenic