ID: 1078868855

View in Genome Browser
Species Human (GRCh38)
Location 11:15325320-15325342
Sequence CCCTAAAAGCTGTGGCTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078868849_1078868855 -9 Left 1078868849 11:15325306-15325328 CCTTCCTGTCCCTGCCCTAAAAG No data
Right 1078868855 11:15325320-15325342 CCCTAAAAGCTGTGGCTCTTTGG No data
1078868848_1078868855 -8 Left 1078868848 11:15325305-15325327 CCCTTCCTGTCCCTGCCCTAAAA No data
Right 1078868855 11:15325320-15325342 CCCTAAAAGCTGTGGCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078868855 Original CRISPR CCCTAAAAGCTGTGGCTCTT TGG Intergenic
No off target data available for this crispr