ID: 1078869458

View in Genome Browser
Species Human (GRCh38)
Location 11:15329954-15329976
Sequence GACCCACTAGGTTGCCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078869458_1078869462 -4 Left 1078869458 11:15329954-15329976 CCAGTCTGGCAACCTAGTGGGTC No data
Right 1078869462 11:15329973-15329995 GGTCCTACCTGGTCCAAGGAAGG No data
1078869458_1078869463 -3 Left 1078869458 11:15329954-15329976 CCAGTCTGGCAACCTAGTGGGTC No data
Right 1078869463 11:15329974-15329996 GTCCTACCTGGTCCAAGGAAGGG No data
1078869458_1078869461 -8 Left 1078869458 11:15329954-15329976 CCAGTCTGGCAACCTAGTGGGTC No data
Right 1078869461 11:15329969-15329991 AGTGGGTCCTACCTGGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078869458 Original CRISPR GACCCACTAGGTTGCCAGAC TGG (reversed) Intergenic
No off target data available for this crispr