ID: 1078878180

View in Genome Browser
Species Human (GRCh38)
Location 11:15419329-15419351
Sequence TAGGCAGAACAACCCCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078878176_1078878180 16 Left 1078878176 11:15419290-15419312 CCTGGAAGATAGCCAGGGAGGTC No data
Right 1078878180 11:15419329-15419351 TAGGCAGAACAACCCCAAACTGG No data
1078878171_1078878180 26 Left 1078878171 11:15419280-15419302 CCATTAGAACCCTGGAAGATAGC No data
Right 1078878180 11:15419329-15419351 TAGGCAGAACAACCCCAAACTGG No data
1078878178_1078878180 4 Left 1078878178 11:15419302-15419324 CCAGGGAGGTCTGGAGAATGCTA No data
Right 1078878180 11:15419329-15419351 TAGGCAGAACAACCCCAAACTGG No data
1078878175_1078878180 17 Left 1078878175 11:15419289-15419311 CCCTGGAAGATAGCCAGGGAGGT No data
Right 1078878180 11:15419329-15419351 TAGGCAGAACAACCCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078878180 Original CRISPR TAGGCAGAACAACCCCAAAC TGG Intergenic
No off target data available for this crispr