ID: 1078878808

View in Genome Browser
Species Human (GRCh38)
Location 11:15426858-15426880
Sequence CTGGTTGGGAAGTTCTGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078878802_1078878808 7 Left 1078878802 11:15426828-15426850 CCCTGCAGCACTGAATTAGCTGG No data
Right 1078878808 11:15426858-15426880 CTGGTTGGGAAGTTCTGACACGG No data
1078878804_1078878808 6 Left 1078878804 11:15426829-15426851 CCTGCAGCACTGAATTAGCTGGT No data
Right 1078878808 11:15426858-15426880 CTGGTTGGGAAGTTCTGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078878808 Original CRISPR CTGGTTGGGAAGTTCTGACA CGG Intergenic
No off target data available for this crispr