ID: 1078881418

View in Genome Browser
Species Human (GRCh38)
Location 11:15452672-15452694
Sequence TAGGATTCCAAAGTTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078881415_1078881418 2 Left 1078881415 11:15452647-15452669 CCTGGGCTCATTCACATGGCCAT No data
Right 1078881418 11:15452672-15452694 TAGGATTCCAAAGTTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078881418 Original CRISPR TAGGATTCCAAAGTTCCTGC AGG Intergenic
No off target data available for this crispr