ID: 1078883921

View in Genome Browser
Species Human (GRCh38)
Location 11:15480908-15480930
Sequence GACAGATGAACTTTAGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078883921_1078883927 8 Left 1078883921 11:15480908-15480930 CCATATCCTAAAGTTCATCTGTC No data
Right 1078883927 11:15480939-15480961 ATGGAAATGGATTGGTGGAGAGG No data
1078883921_1078883926 3 Left 1078883921 11:15480908-15480930 CCATATCCTAAAGTTCATCTGTC No data
Right 1078883926 11:15480934-15480956 GTAAAATGGAAATGGATTGGTGG No data
1078883921_1078883928 18 Left 1078883921 11:15480908-15480930 CCATATCCTAAAGTTCATCTGTC No data
Right 1078883928 11:15480949-15480971 ATTGGTGGAGAGGTGTGTACAGG No data
1078883921_1078883924 -5 Left 1078883921 11:15480908-15480930 CCATATCCTAAAGTTCATCTGTC No data
Right 1078883924 11:15480926-15480948 CTGTCTATGTAAAATGGAAATGG No data
1078883921_1078883925 0 Left 1078883921 11:15480908-15480930 CCATATCCTAAAGTTCATCTGTC No data
Right 1078883925 11:15480931-15480953 TATGTAAAATGGAAATGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078883921 Original CRISPR GACAGATGAACTTTAGGATA TGG (reversed) Intergenic
No off target data available for this crispr