ID: 1078886769

View in Genome Browser
Species Human (GRCh38)
Location 11:15508096-15508118
Sequence TAGCAAACTCAATTTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078886769_1078886770 -7 Left 1078886769 11:15508096-15508118 CCAGCAGAAAATTGAGTTTGCTA No data
Right 1078886770 11:15508112-15508134 TTTGCTACTTCCCCAAGATGTGG No data
1078886769_1078886779 28 Left 1078886769 11:15508096-15508118 CCAGCAGAAAATTGAGTTTGCTA No data
Right 1078886779 11:15508147-15508169 GCTAGGGCTTTTCTTGTCACAGG No data
1078886769_1078886777 11 Left 1078886769 11:15508096-15508118 CCAGCAGAAAATTGAGTTTGCTA No data
Right 1078886777 11:15508130-15508152 TGTGGGTGCTAAAATGGGCTAGG No data
1078886769_1078886778 12 Left 1078886769 11:15508096-15508118 CCAGCAGAAAATTGAGTTTGCTA No data
Right 1078886778 11:15508131-15508153 GTGGGTGCTAAAATGGGCTAGGG No data
1078886769_1078886771 -6 Left 1078886769 11:15508096-15508118 CCAGCAGAAAATTGAGTTTGCTA No data
Right 1078886771 11:15508113-15508135 TTGCTACTTCCCCAAGATGTGGG No data
1078886769_1078886776 6 Left 1078886769 11:15508096-15508118 CCAGCAGAAAATTGAGTTTGCTA No data
Right 1078886776 11:15508125-15508147 CAAGATGTGGGTGCTAAAATGGG No data
1078886769_1078886775 5 Left 1078886769 11:15508096-15508118 CCAGCAGAAAATTGAGTTTGCTA No data
Right 1078886775 11:15508124-15508146 CCAAGATGTGGGTGCTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078886769 Original CRISPR TAGCAAACTCAATTTTCTGC TGG (reversed) Intergenic
No off target data available for this crispr