ID: 1078889568

View in Genome Browser
Species Human (GRCh38)
Location 11:15542351-15542373
Sequence AGGTCACATGCACTTCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078889568_1078889570 -7 Left 1078889568 11:15542351-15542373 CCAAGAAGAAGTGCATGTGACCT No data
Right 1078889570 11:15542367-15542389 GTGACCTGACAGCTGAAGTAGGG No data
1078889568_1078889574 12 Left 1078889568 11:15542351-15542373 CCAAGAAGAAGTGCATGTGACCT No data
Right 1078889574 11:15542386-15542408 AGGGACATAGGCACTACCTTGGG No data
1078889568_1078889572 0 Left 1078889568 11:15542351-15542373 CCAAGAAGAAGTGCATGTGACCT No data
Right 1078889572 11:15542374-15542396 GACAGCTGAAGTAGGGACATAGG No data
1078889568_1078889569 -8 Left 1078889568 11:15542351-15542373 CCAAGAAGAAGTGCATGTGACCT No data
Right 1078889569 11:15542366-15542388 TGTGACCTGACAGCTGAAGTAGG No data
1078889568_1078889573 11 Left 1078889568 11:15542351-15542373 CCAAGAAGAAGTGCATGTGACCT No data
Right 1078889573 11:15542385-15542407 TAGGGACATAGGCACTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078889568 Original CRISPR AGGTCACATGCACTTCTTCT TGG (reversed) Intergenic
No off target data available for this crispr