ID: 1078889570

View in Genome Browser
Species Human (GRCh38)
Location 11:15542367-15542389
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078889568_1078889570 -7 Left 1078889568 11:15542351-15542373 CCAAGAAGAAGTGCATGTGACCT No data
Right 1078889570 11:15542367-15542389 GTGACCTGACAGCTGAAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078889570 Original CRISPR GTGACCTGACAGCTGAAGTA GGG Intergenic
No off target data available for this crispr