ID: 1078894154

View in Genome Browser
Species Human (GRCh38)
Location 11:15583388-15583410
Sequence CTCATAACAGGGGGTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078894148_1078894154 -3 Left 1078894148 11:15583368-15583390 CCACTTTATAAATCCGGCAGCTC No data
Right 1078894154 11:15583388-15583410 CTCATAACAGGGGGTTTCACTGG No data
1078894145_1078894154 14 Left 1078894145 11:15583351-15583373 CCAAACAAAAACCACTACCACTT No data
Right 1078894154 11:15583388-15583410 CTCATAACAGGGGGTTTCACTGG No data
1078894142_1078894154 28 Left 1078894142 11:15583337-15583359 CCTAAAGGCCTGTCCCAAACAAA No data
Right 1078894154 11:15583388-15583410 CTCATAACAGGGGGTTTCACTGG No data
1078894143_1078894154 20 Left 1078894143 11:15583345-15583367 CCTGTCCCAAACAAAAACCACTA No data
Right 1078894154 11:15583388-15583410 CTCATAACAGGGGGTTTCACTGG No data
1078894146_1078894154 3 Left 1078894146 11:15583362-15583384 CCACTACCACTTTATAAATCCGG No data
Right 1078894154 11:15583388-15583410 CTCATAACAGGGGGTTTCACTGG No data
1078894144_1078894154 15 Left 1078894144 11:15583350-15583372 CCCAAACAAAAACCACTACCACT No data
Right 1078894154 11:15583388-15583410 CTCATAACAGGGGGTTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078894154 Original CRISPR CTCATAACAGGGGGTTTCAC TGG Intergenic
No off target data available for this crispr