ID: 1078895145

View in Genome Browser
Species Human (GRCh38)
Location 11:15591295-15591317
Sequence GCCCTTGCTCTGATAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078895139_1078895145 -1 Left 1078895139 11:15591273-15591295 CCACAGAACTGTCAATGGCCCAG No data
Right 1078895145 11:15591295-15591317 GCCCTTGCTCTGATAAGGGAGGG No data
1078895137_1078895145 7 Left 1078895137 11:15591265-15591287 CCTGTGGACCACAGAACTGTCAA No data
Right 1078895145 11:15591295-15591317 GCCCTTGCTCTGATAAGGGAGGG No data
1078895135_1078895145 25 Left 1078895135 11:15591247-15591269 CCTTCTAGGACACTTTGGCCTGT No data
Right 1078895145 11:15591295-15591317 GCCCTTGCTCTGATAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078895145 Original CRISPR GCCCTTGCTCTGATAAGGGA GGG Intergenic
No off target data available for this crispr