ID: 1078896126

View in Genome Browser
Species Human (GRCh38)
Location 11:15598877-15598899
Sequence ATATGGTAGCTGGATGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078896126_1078896131 4 Left 1078896126 11:15598877-15598899 CCTTCTCCATCCAGCTACCATAT No data
Right 1078896131 11:15598904-15598926 CAGCCCATACATTGAGACACTGG No data
1078896126_1078896135 11 Left 1078896126 11:15598877-15598899 CCTTCTCCATCCAGCTACCATAT No data
Right 1078896135 11:15598911-15598933 TACATTGAGACACTGGGTTATGG No data
1078896126_1078896132 5 Left 1078896126 11:15598877-15598899 CCTTCTCCATCCAGCTACCATAT No data
Right 1078896132 11:15598905-15598927 AGCCCATACATTGAGACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078896126 Original CRISPR ATATGGTAGCTGGATGGAGA AGG (reversed) Intergenic
No off target data available for this crispr