ID: 1078897956

View in Genome Browser
Species Human (GRCh38)
Location 11:15614874-15614896
Sequence CACCAGAGCCTGCATCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078897956_1078897958 10 Left 1078897956 11:15614874-15614896 CCACAGGGATGCAGGCTCTGGTG No data
Right 1078897958 11:15614907-15614929 TTGAAGTCATGAGCTCCAGATGG No data
1078897956_1078897960 30 Left 1078897956 11:15614874-15614896 CCACAGGGATGCAGGCTCTGGTG No data
Right 1078897960 11:15614927-15614949 TGGACCAGATGATGCTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078897956 Original CRISPR CACCAGAGCCTGCATCCCTG TGG (reversed) Intergenic
No off target data available for this crispr