ID: 1078900692

View in Genome Browser
Species Human (GRCh38)
Location 11:15639696-15639718
Sequence CTGTAATAGCAGTGGCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078900692_1078900699 19 Left 1078900692 11:15639696-15639718 CCTTGGAGCCACTGCTATTACAG No data
Right 1078900699 11:15639738-15639760 AGATAAAATATTTGACAGAAAGG No data
1078900692_1078900700 20 Left 1078900692 11:15639696-15639718 CCTTGGAGCCACTGCTATTACAG No data
Right 1078900700 11:15639739-15639761 GATAAAATATTTGACAGAAAGGG No data
1078900692_1078900695 -9 Left 1078900692 11:15639696-15639718 CCTTGGAGCCACTGCTATTACAG No data
Right 1078900695 11:15639710-15639732 CTATTACAGAGGCAGTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078900692 Original CRISPR CTGTAATAGCAGTGGCTCCA AGG (reversed) Intergenic
No off target data available for this crispr