ID: 1078900695

View in Genome Browser
Species Human (GRCh38)
Location 11:15639710-15639732
Sequence CTATTACAGAGGCAGTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078900690_1078900695 7 Left 1078900690 11:15639680-15639702 CCTCTGCACTTGGCCGCCTTGGA No data
Right 1078900695 11:15639710-15639732 CTATTACAGAGGCAGTTTTAAGG No data
1078900688_1078900695 13 Left 1078900688 11:15639674-15639696 CCTGAACCTCTGCACTTGGCCGC No data
Right 1078900695 11:15639710-15639732 CTATTACAGAGGCAGTTTTAAGG No data
1078900692_1078900695 -9 Left 1078900692 11:15639696-15639718 CCTTGGAGCCACTGCTATTACAG No data
Right 1078900695 11:15639710-15639732 CTATTACAGAGGCAGTTTTAAGG No data
1078900686_1078900695 15 Left 1078900686 11:15639672-15639694 CCCCTGAACCTCTGCACTTGGCC No data
Right 1078900695 11:15639710-15639732 CTATTACAGAGGCAGTTTTAAGG No data
1078900687_1078900695 14 Left 1078900687 11:15639673-15639695 CCCTGAACCTCTGCACTTGGCCG No data
Right 1078900695 11:15639710-15639732 CTATTACAGAGGCAGTTTTAAGG No data
1078900691_1078900695 -6 Left 1078900691 11:15639693-15639715 CCGCCTTGGAGCCACTGCTATTA No data
Right 1078900695 11:15639710-15639732 CTATTACAGAGGCAGTTTTAAGG No data
1078900684_1078900695 28 Left 1078900684 11:15639659-15639681 CCTGCTGGAGTTTCCCCTGAACC No data
Right 1078900695 11:15639710-15639732 CTATTACAGAGGCAGTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078900695 Original CRISPR CTATTACAGAGGCAGTTTTA AGG Intergenic
No off target data available for this crispr