ID: 1078900699

View in Genome Browser
Species Human (GRCh38)
Location 11:15639738-15639760
Sequence AGATAAAATATTTGACAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078900692_1078900699 19 Left 1078900692 11:15639696-15639718 CCTTGGAGCCACTGCTATTACAG No data
Right 1078900699 11:15639738-15639760 AGATAAAATATTTGACAGAAAGG No data
1078900691_1078900699 22 Left 1078900691 11:15639693-15639715 CCGCCTTGGAGCCACTGCTATTA No data
Right 1078900699 11:15639738-15639760 AGATAAAATATTTGACAGAAAGG No data
1078900694_1078900699 11 Left 1078900694 11:15639704-15639726 CCACTGCTATTACAGAGGCAGTT No data
Right 1078900699 11:15639738-15639760 AGATAAAATATTTGACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078900699 Original CRISPR AGATAAAATATTTGACAGAA AGG Intergenic
No off target data available for this crispr