ID: 1078903948

View in Genome Browser
Species Human (GRCh38)
Location 11:15666936-15666958
Sequence CTTTCCTTACGGATCGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078903942_1078903948 -5 Left 1078903942 11:15666918-15666940 CCCAATCTCTCAGACATCCTTTC No data
Right 1078903948 11:15666936-15666958 CTTTCCTTACGGATCGTGGGTGG No data
1078903937_1078903948 30 Left 1078903937 11:15666883-15666905 CCTTAGGATCTGGCTCATTCAGG No data
Right 1078903948 11:15666936-15666958 CTTTCCTTACGGATCGTGGGTGG No data
1078903943_1078903948 -6 Left 1078903943 11:15666919-15666941 CCAATCTCTCAGACATCCTTTCC No data
Right 1078903948 11:15666936-15666958 CTTTCCTTACGGATCGTGGGTGG No data
1078903941_1078903948 -4 Left 1078903941 11:15666917-15666939 CCCCAATCTCTCAGACATCCTTT No data
Right 1078903948 11:15666936-15666958 CTTTCCTTACGGATCGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078903948 Original CRISPR CTTTCCTTACGGATCGTGGG TGG Intergenic
No off target data available for this crispr