ID: 1078904379

View in Genome Browser
Species Human (GRCh38)
Location 11:15670847-15670869
Sequence AATGGAGCAGCCGCCGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078904375_1078904379 4 Left 1078904375 11:15670820-15670842 CCTATGGAAAAGAATACACACCA No data
Right 1078904379 11:15670847-15670869 AATGGAGCAGCCGCCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078904379 Original CRISPR AATGGAGCAGCCGCCGGCCC AGG Intergenic
No off target data available for this crispr