ID: 1078907116

View in Genome Browser
Species Human (GRCh38)
Location 11:15697854-15697876
Sequence TGCCACAGCTAAGGCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078907112_1078907116 -8 Left 1078907112 11:15697839-15697861 CCAACATGACAAGACTGCCACAG No data
Right 1078907116 11:15697854-15697876 TGCCACAGCTAAGGCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078907116 Original CRISPR TGCCACAGCTAAGGCTCCTG GGG Intergenic
No off target data available for this crispr