ID: 1078909241

View in Genome Browser
Species Human (GRCh38)
Location 11:15715735-15715757
Sequence CGTGGGGCATGATTCTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078909237_1078909241 -7 Left 1078909237 11:15715719-15715741 CCCCATTCATCTTGGGCGTGGGG No data
Right 1078909241 11:15715735-15715757 CGTGGGGCATGATTCTGTACTGG No data
1078909235_1078909241 -6 Left 1078909235 11:15715718-15715740 CCCCCATTCATCTTGGGCGTGGG No data
Right 1078909241 11:15715735-15715757 CGTGGGGCATGATTCTGTACTGG No data
1078909228_1078909241 30 Left 1078909228 11:15715682-15715704 CCCTCTATCACCTCCTATGGGAA No data
Right 1078909241 11:15715735-15715757 CGTGGGGCATGATTCTGTACTGG No data
1078909239_1078909241 -8 Left 1078909239 11:15715720-15715742 CCCATTCATCTTGGGCGTGGGGC No data
Right 1078909241 11:15715735-15715757 CGTGGGGCATGATTCTGTACTGG No data
1078909231_1078909241 17 Left 1078909231 11:15715695-15715717 CCTATGGGAAAAGTGCTCTTTTG No data
Right 1078909241 11:15715735-15715757 CGTGGGGCATGATTCTGTACTGG No data
1078909230_1078909241 20 Left 1078909230 11:15715692-15715714 CCTCCTATGGGAAAAGTGCTCTT No data
Right 1078909241 11:15715735-15715757 CGTGGGGCATGATTCTGTACTGG No data
1078909240_1078909241 -9 Left 1078909240 11:15715721-15715743 CCATTCATCTTGGGCGTGGGGCA No data
Right 1078909241 11:15715735-15715757 CGTGGGGCATGATTCTGTACTGG No data
1078909229_1078909241 29 Left 1078909229 11:15715683-15715705 CCTCTATCACCTCCTATGGGAAA No data
Right 1078909241 11:15715735-15715757 CGTGGGGCATGATTCTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078909241 Original CRISPR CGTGGGGCATGATTCTGTAC TGG Intergenic
No off target data available for this crispr