ID: 1078911317

View in Genome Browser
Species Human (GRCh38)
Location 11:15735041-15735063
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078911310_1078911317 30 Left 1078911310 11:15734988-15735010 CCGTGACAACTTTATTGTATAAT No data
Right 1078911317 11:15735041-15735063 GACAGAAGGACTTTGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078911317 Original CRISPR GACAGAAGGACTTTGGCAGC AGG Intergenic
No off target data available for this crispr