ID: 1078911644

View in Genome Browser
Species Human (GRCh38)
Location 11:15738235-15738257
Sequence GTGACCTTCTCAAGATCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078911639_1078911644 13 Left 1078911639 11:15738199-15738221 CCCCAATGAGAATACCAAGATGC No data
Right 1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG No data
1078911642_1078911644 -1 Left 1078911642 11:15738213-15738235 CCAAGATGCGAAATGTCTCAGAG No data
Right 1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG No data
1078911641_1078911644 11 Left 1078911641 11:15738201-15738223 CCAATGAGAATACCAAGATGCGA No data
Right 1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG No data
1078911640_1078911644 12 Left 1078911640 11:15738200-15738222 CCCAATGAGAATACCAAGATGCG No data
Right 1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG No data
1078911638_1078911644 22 Left 1078911638 11:15738190-15738212 CCTCTTTTTCCCCAATGAGAATA No data
Right 1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078911644 Original CRISPR GTGACCTTCTCAAGATCACA GGG Intergenic
No off target data available for this crispr