ID: 1078914931

View in Genome Browser
Species Human (GRCh38)
Location 11:15770282-15770304
Sequence GGTGACATGCTTGAAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1078914931_1078914936 8 Left 1078914931 11:15770282-15770304 CCATTCACTTCAAGCATGTCACC No data
Right 1078914936 11:15770313-15770335 CCACAACAACCCTGTAAGGAAGG No data
1078914931_1078914933 4 Left 1078914931 11:15770282-15770304 CCATTCACTTCAAGCATGTCACC No data
Right 1078914933 11:15770309-15770331 ATTCCCACAACAACCCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1078914931 Original CRISPR GGTGACATGCTTGAAGTGAA TGG (reversed) Intergenic
No off target data available for this crispr